Labshake search
Citations for GenScript :
1 - 50 of 514 citations for PD L1 Human HEK293 Flag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length cDNA of PD-L1-lnc was synthesized and cloned into pcDNA3.1-P2A-eGFP vector (GenScript, China). To suppress PD-L1-lnc ...
-
bioRxiv - Immunology 2022Quote: ... using eBlot L1 (GenScript). Membranes were blocked and stained with primary antibody overnight in 5% nonfat dry milk in 0.1% PBST ...
-
bioRxiv - Neuroscience 2021Quote: ... DYKDDDDK (Flag)-tagged human FAM57B plasmid was purchased from Genscript. Hemagglutinin (HA)-tagged human CerS plasmids were generated as described76.
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC3 plasmid was purchased from GenScript (catalog #: OHu03021D). The human FLAG-tagged EMC5 plasmid (catalog # ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were transferred to PVDF membranes with the eBlot® L1 system using eBlot® L1 Transfer Stack supports (Genscript) and the resulting membranes were washed three times with TBS-T (Tris-buffered saline containing 0.1 % Tween® 20 (Merk)) ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Gels were transferred through eBlot L1 (GenScript L00686) onto nitrocellulose membranes (BioRad 1620112) ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... nonreducing gels and transferred using eBlot L1 Transfer system (GenScript). Blots were blocked in 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the eBlot™ L1 Fast Wet Transfer System (GenScript) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... using an eBlot™ L1 wet transfer (GenScript Biotech, China). Membranes were blocked and incubated with primary antibodies and secondary antibodies using eZwest Lite Automated Western Device (GenScript Biotech ...
-
bioRxiv - Genetics 2023Quote: The expression vector for C-terminally Flag-tagged full-length human GDF15 was obtained from Genscript. The C211G mutant was generated by site-directed mutagenesis of the wild-type vector using the QuikChange II protocol (Agilent) ...
-
bioRxiv - Zoology 2020Quote: ... Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript).
-
bioRxiv - Cell Biology 2022Quote: ... Protein was transferred to a PVDF membrane using eBlot L1 (Genscript). Blocking was performed with 5% milk in PBST (PBS + 0.1% TritonX-100 ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by staining using the eStain L1 Protein Staining System (GenScript). PAGE-MASTER Protein Standard Plus (GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... and human CDC73 sequences with an N-terminal Flag tag were synthesized and sequences confirmed by GenScript. The human ubiquitin sequence with an inserted N-terminal cysteine residue was synthesized by Eurofins ...
-
bioRxiv - Cell Biology 2021Quote: ... Flag (Genscript), anti-p44/42 MAPK (Erk1/2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Clone OHu31338D containing the open reading frame of the human ALKBH3 in pcDNA3.1 with C-terminal FLAG tag was obtained from GenScript, U.S.A ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Plant Biology 2023Quote: ... and transferred to PVDF membrane using an eBlot™ L1 transfer system (GenScript). The target proteins were probed with corresponding antibodies.
-
bioRxiv - Microbiology 2019Quote: ... Anti-Flag (GenScript), Anti-c-Myc (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Human CLEC16A C-terminal Flag epitope-tagged full-length or alternatively spliced disease isoform vectors (Genscript; OHu18264D and OHu02258D). Constructs containing CLEC16A ΔC (1-892 only ...
-
bioRxiv - Molecular Biology 2023Quote: ... A human SCAPER cDNA construct with C-terminal FLAG-tag in a pcDNA3.1 vector was obtained from Genscript (cloneID OHu03552) and subsequently cloned into pcDNA5/FRT/TO vectors with N- or C-terminal FLAG-tags ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag affinity beads (Genscript) or HA magnetic beads (Bimake ...
-
bioRxiv - Microbiology 2019Quote: ... HuR-Flag (GenScript #OHu23723D), or G3BP1-Flag (GenScript #OHu02150D ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-FLAG (Genscript) antibodies ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... anti-Flag (A00187; Genscript) or anti-phosphorylated NF-κB (S536 ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... and Flag (A00187; Genscript) antibodies overnight at 4° C ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... control Flag (A00187; Genscript) and total NF-κB (8242 ...
-
bioRxiv - Cell Biology 2022Quote: ... pCDNA3.1-HCAR1-flag (Genscript) was used for C-terminal flag tagging ...
-
bioRxiv - Biochemistry 2023Quote: ... an α-FLAG (GenScript) monoclonal antibody was used to probe for FLAG-tagged SufI or FLAG-tagged SufI-pep86 followed by a horseradish peroxidase-conjugated α-mouse antibody (Santa Cruz Biotechnology Inc.) ...
-
bioRxiv - Plant Biology 2022Quote: ... Sample in the gel were transferred to PVDF membrane using eBlot™ L1 (GenScript Corporation). Anti-HA (1:5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... FLAG-AR-WT-MTID or FLAG-22YtoS-MTID were subcloned from pcDNA3.1(-) (Genscript) into pLenti-CMV-MCS-GFP-SV-puro (addgene #73582 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Microbiology 2019Quote: ... or G3BP1-Flag (GenScript #OHu02150D) plasmids using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-FLAG (Genscript); 4 ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... or anti-Flag (A00187; Genscript) primary antibodies ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... LMX1B-FLAG in pcDNA3.1 (Genscript), or pLVX-puro plasmids were used ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-FLAG antibody (GenScript #A00187) was incubated in 10% FBS and 1xPBS for 1 h at 37°C at a concentration of 1μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG (A00187, GenScript (1:1,000)) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.1-IKKε-Flag (OHu2671; Genscript), pcDNA3.1-empty (Genscript) ...