Labshake search
Citations for GenScript :
1 - 50 of 834 citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: Human His-CLASP1 (NM_015282.2) in pFastBacHT vector was purchased from Genscript. The cDNA encoding full-length human CLASP2α was purchased from Dharmacon (Accession ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the mouse anti-His (A00186, GenScript, 1:5000 diluted), and the rabbit anti-HA (902303 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Bioengineering 2024Quote: ... iFluor 647-conjugated anti-His-tag antibody (pilot CYpHER detection and TfR human/mouse cross-reactivity, Genscript A01802); Alexa Fluor 647-conjugated anti-Fc Fab (Surface protein and CYpHER quantitation ...
-
bioRxiv - Biochemistry 2023Quote: ... His-ERK was further purified using 1 mL glutathione resin (GenScript) to remove any residual GST-tagged MKK1.
-
bioRxiv - Microbiology 2020Quote: ... 50 ng of His-tagged RBD (His-RBD, aa 319-541) (Genscript) was then added to each well and incubated at 37°C for 2 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminally His-tagged construct encoding human UGGT1 residues 43-1551 was PCR-amplified from the commercially sourced vector UGGT1-pUC57 (GenScript) with primers ...
-
bioRxiv - Immunology 2022Quote: For immunoprecipitation, 10×106 human peripheral blood monocytes cells were treated with SARS-CoV-2 Spike protein (RBD, His Tag) (GenScript) 100 ng/ml for 2 hours ...
-
bioRxiv - Biophysics 2022Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript. C0-C2 mutants were engineered using a Q5 Site-Directed Mutagenesis Kit (New England Bio Labs) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Cancer Biology 2020Quote: ... the PD-L1-lnc shRNA vectors were synthesized and then cloned into pLKO.1 vector (GenScript, China). The siRNA target sequences were listed in table S3 ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Microbiology 2021Quote: ... His-tagged AtxA was detected using anti-His antibody (GenScript USA Inc., Piscataway, NJ, USA). RNA polymerase subunit β was used as a loading control and detected using anti-RNAP antibody (Thermo fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Microbiology 2020Quote: ... THE™ Anti-His-HRP (Genscript).
-
bioRxiv - Plant Biology 2023Quote: ... Hexa-His peptide (Genscript, Inc., NJ) was used as a control ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... The pESC-HIS-hMfsd7c plasmid (Genscript) was used for overexpression on the yeast S ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Microbiology 2019Quote: ... we used the mouse α-HIS Tag monoclonal antibody at 1:1000 (Genscript, Piscataway, NJ). To detect mammalian expression constructs of NS1-2 ...
-
Bacterial killing by complement requires direct anchoring of Membrane Attack Complex precursor C5b-7bioRxiv - Immunology 2019Quote: ... 50 µM of LPETG-His tagged protein was incubated with 1 mM GGG-azide (Genscript) and 25 µM His-tagged sortase-A7+ (recombinantly expressed in E ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Microbiology 2023Quote: Genes encoding His-tagged ectodomain versions of the HSV-1 gD receptors HVEM (HVEM200t) or nectin-1 (nectin345t) were synthesized by GenScript (GenBank accession numbers AF060231 and U70321 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Plant Biology 2019Quote: ... HIS-TAN1 and HIS-TAN1-GFP concentrations were checked with a BCA protein assay (Genscript Corp Piscataway, New Jersey USA). After refolding ...
-
bioRxiv - Synthetic Biology 2022Quote: ... linker with both N-terminal and C-terminal 10×His-tags with a cysteine adjacent to each 10×His tag in a pET21b vector (Genscript). The plasmid was transformed into T7 express cells (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The successful removal of His-tag was validated by western blot using the anti-His-tag antibody (Genscript, A00186-100).
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biophysics 2020Quote: ... To determine the binding affinities between antigens and antibody mouse monoclonal anti-His-tag IgG (clone 6G2A9, The™ His tag Ab, GenScript) was captured on the surface of active flow cell to the level of 100-200 RU ...