Labshake search
Citations for GenScript :
1 - 50 of 155 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the QuickClean 5M PCR Purification Kit (GenScript, Piscataway, NJ, USA). NanoDrop ND-100 Spectrophotometer (NanoDrop Technologies ...
-
bioRxiv - Genetics 2024Quote: ... and cloning into the pJR1-41XL vector116 with the CloneEZ PCR Cloning Kit (GenScript). Plasmids were checked by PCR for correct insert size and also by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Physiology 2022Quote: ... The purified PCR products and linearized vectors were assembled using a GenBuilder Plus kit (Genscript, L00744-10) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The GtACR1-EYFP fragment from the p7-GtCAR1 plasmid was swapped in using CloneEZ® PCR Cloning Kit (GenScript) for the myr::GFP fragment in pJFRC177 and the sequence was verified (GenScript) ...
-
bioRxiv - Genetics 2021Quote: ... The predicted full-length lincRNA sequences were amplified by PCR and cloned into the pJR1-41XL vector (Moreno, Durán and Ribas, 2000) using the CloneEZ® PCR Cloning Kit (GenScript). Each plasmid was checked by PCR for correct insert size ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF was subcloned into the BamH1 site of pCS2+ (pCS2+-sobp) using the Clone EZ PCR cloning kit (GenScript). pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragment was then inserted into the KpnI and HindIII digested pLJ-Ssc70-Myc backbone using the CloneEZ™ PCR Cloning Kit (GenScript) to get pLJ-Hsp70-Myc plasmid ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were Sanger sequenced by GenScript, and sequences were analyzed using IMGT/V-QUEST (32).
-
bioRxiv - Immunology 2020Quote: ... PCR products were Sanger sequenced by Genscript and sequences were analyzed using IMGT/V-QUEST (33) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were Sanger sequenced by Genscript.
-
bioRxiv - Microbiology 2022Quote: ... PCR amplifications were performed with Taq DNA Polymerase (GenScript) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... CCT isoforms were PCR amplified from synthetic vectors from GenScript. SpCas9 was PCR amplified from px4591 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Point mutations were introduced by the PCR CloneEZ method (GenScript). Plasmids were transformed in acrB-deficient MG1655 E ...
-
bioRxiv - Plant Biology 2021Quote: ... The purified PCR amplicons were sequenced using Sanger sequencing (Genscript, NJ). The overlapping PCR amplicon sequences were aligned and comparative analysis with the WT sequences was used to identify mutations for each of the independent nec3 mutants.
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were generated by PCR or DNA synthesis (Genscript, New Jersey) containing ∼500-1000 bp DNA flanking each gene and fused together ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072 ...
-
bioRxiv - Biophysics 2023Quote: ... FRET-labeled 207 bp DNA was prepared by PCR using labeled primers (GenScript) ATCGGACCC/iCy5N/ATACGCGGCC (forward primer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Templates for sgRNA transcription were generated by PCR amplifying synthesized fragments (IDT and Genscript) or by annealing a T7 primer oligo to a single stranded template oligonucleotide ...
-
bioRxiv - Microbiology 2019Quote: ... Primer synthesis and the sequencing of PCR products or plasmids were performed by Genscript Biotech (Nanjing ...
-
bioRxiv - Biochemistry 2023Quote: ... the PCR amplified sfGFP sequence was first subcloned into vector pUC57 containing synthesized (GenScript) C-terminus for 3C-STREP-KKCKK-GFP11 (pFMP249) ...
-
bioRxiv - Biochemistry 2024Quote: ... the coding sequences for the PINK1 constructs were PCR amplified using clone OHu25380D (Genscript) as a template and cloned into the vector pFB-6HZB (SGC ...
-
bioRxiv - Biophysics 2021Quote: ... cyaA DNA was amplified from genomic DNA by PCR and cloned in pET-15b (GenScript) using AsuII and NcoI enzymes to generate plasmid pME14 ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed with Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript wesite (www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool ...
-
bioRxiv - Bioengineering 2022Quote: ... and gene expression was examined by real-time PCR using primer pairs (Genscript, Nanjing, China) and SYBR Green (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting DNA was used as template for PCR amplification using Taq DNA polymerase (Genscript). DNA fragments resolved with electrophoresis of 1.2% Agarose gel purified using the Gel Extraction Kit (Qiagen ...
-
bioRxiv - Genomics 2023Quote: The ACE2 coding sequence was synthesized by PCR amplification from the pUC57-ACE2 plasmid (GenScript). We included a NheI restriction site at the 5’ terminus and a PmeI restriction site at the 3’ terminus ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Microbiology 2019Quote: ... cdeR and cseR were made by introducing PCR-generated amplicons or synthetic gene fragments (IDT or Genscript) into pEX18Gm-derived delivery plasmid (39) ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting PCR products were analyzed by agarose gel electrophoresis and DNA sequencing (GenScript Biotech Corp., Nanjing, China).
-
bioRxiv - Cancer Biology 2022Quote: Human RET-GFP and RET712-1114-GFP were cloned by PCR using a cDNA clone (GenScript Biotech; NM_020975.6) as template ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR products were analysed by agarose gel electrophoresis and confirmed by Sanger sequencing (GenScript, Nanjing, China). The genome editing plasmids were cured following the method we previously developed (Zheng et al ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... MCM7 or CDC45 were amplified by PCR using Phusion polymerase (Thermo) from pcDNA3.1 plasmids encoding the cDNA of each protein (MCM plasmids from Genscript). The PCR products were then cloned into the pGBKT7-BD or pGADT7-AD plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... hnRNPUL1 (NM_007040) and PEG10 (NM_015068.3) were PCR amplified from ORF clones (hnRNPL, GenScript #OHu14072; hnRNPUL1, Origene #RC200576; PEG10, GenScript #OHu101111) and the products were cloned into the mammalian expression plasmid pCAGGS ...
-
bioRxiv - Microbiology 2022Quote: All constructs were PCR amplified from a codon optimized gene block encoding the coding sequence of human DYRK1A (GenScript) using Q5 High-Fidelity DNA Polymerase with GC enhancer buffer (New England Biolabs) ...
-
bioRxiv - Bioengineering 2022Quote: ... by means of overhang PCR and was cloned via traditional restriction/ligation into a pET28a(+) plasmid (ordered from GenScript) coding for the C-terminal flexible linker and small BiT (SB ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminally His-tagged construct encoding human UGGT1 residues 43-1551 was PCR-amplified from the commercially sourced vector UGGT1-pUC57 (GenScript) with primers ...
-
bioRxiv - Systems Biology 2022Quote: ... The following primers were used for the RT-qPCR reaction (designed with the Real-time PCR (TaqMan) Primer and Probes Design Tool from GenScript).
-
bioRxiv - Molecular Biology 2020Quote: ... A version of the LdNT3 stem-loop was synthesized with flanking BstXI and PCR primer binding sites (Genscript, Piscataway, NJ) and inserted into the BstXI sites of the modified pRP vector.
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... The construct consisting of nucleoplasmic and transmembrane domains of SUN2 and the luminal domain of SUN1 was created by amplifying SUN1 C-terminal fragment (AA 245-511) by PCR from pcDNA3.1+/C-(K)DY-SUN1 vector (OHu26731,GenScript # NM_001130965.3) using 5’-CTGTTCTAGAATGTTGGCTGGCCGTGG-3’forward and 5’-CTGTCTCGAGGCCCTGACTTGCACGTCCA-3’ reverse primers and subsequent cloning into MP029-CRY2-mCherry-SUN2-N-2 vector using the XbaI/XhoI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... was assembled from a PCR performed on a codon-optimized SARS-CoV-2 Omicron BA.1 sequence synthesized by Genscript. Fragments were assembled with a PCR fragment containing the fpl and mNG2(11 ...