Labshake search
Citations for GenScript :
1 - 50 of 462 citations for Native Red Fluorescent Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Fluorescent-tagged phage proteins were synthesized into pDSW206 by Genscript and delivered as lyophilized plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... An additional plasmid encoding green fluorescent protein (GFP; pCAG-GFP; GenScript), was used to label successfully transfected cells ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Biophysics 2023Quote: ... The gene encoding the wild-type hSOD1 of the native sequence was purchased from Genscript with E ...
-
bioRxiv - Immunology 2021Quote: ... The full-length native chicken ovalbumin (OVA) gene inserted in a pcDNA3.1+ plasmid (clone ID: OGa28271) was purchased from GenScript. Gene inserts from pcDNA3.1+ plasmids were cloned into the pAM2AA backbone incorporating the liver-specific human α-1 antitrypsin promoter and human ApoE enhancer flanked by AAV2 inverted terminal repeats ...
-
bioRxiv - Neuroscience 2023Quote: ... and red pigment concentrating hormone (RPCH; GenScript) were prepared as 10−3 M aliquots (PROC and CCAP in distilled water ...
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
bioRxiv - Biochemistry 2020Quote: Binding of the fluorescent transport substrate peptide RRY(CFluorescein)KSTEL (Genscript) to WT and mutant TmrAB was determined as a function of the change in fluorescence polarization as described in [10] ...
-
bioRxiv - Bioengineering 2019Quote: ... OmpT fluorescent peptide substrate was custom ordered from Genscript (Piscataway, NJ).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The fluorescent NOXA and BID peptides (95+% purity) were synthesized by GenScript and were N-terminally labeled with 5-FAM-Ahx and C-terminally modified by amidation ...
-
bioRxiv - Plant Biology 2023Quote: ... SCOOP10 and SCOOP12 peptides were labeled with fluorescent 5-FAM at the N-termini (GenScript, China) and the final working concentration of labelled peptides was adjusted to 0.05 μM with ddH2O ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...
-
bioRxiv - Cancer Biology 2023Quote: ... biotinylated Protein L (GenScript USA) (25) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bis-Tris Protein Gel (GenScript), and blotted ...
-
bioRxiv - Bioengineering 2023Quote: ... recombinant VZV gE protein (Genscript) diluted in coating buffer (Biolegend ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... a library of potential substrates flanked by 5FAM fluorescent dye and DABCYL quencher (5FAM-substrate-Lys{DABCYL}-Amide) was synthesized by Genscript or manufactured in-house using Liberty Blue peptide synthesizer (CEM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Biochemistry 2022Quote: ... And then Protein A beads (GenScript) were used to separate Fab fragments ...
-
bioRxiv - Immunology 2022Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Immunology 2020Quote: ... and recombinant nucleocapsid protein (GenScript Z03488). The following day ...
-
bioRxiv - Immunology 2021Quote: ... and AmMag Protein A beads (Genscript) or loaded on a protein A (Cytiva ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein G coated MagBeads (Genscript #L00274) were equilibrated with Binding/Wash Buffer (20mM Na2HPO4 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a multi-tag protein standard (Genscript) was serially diluted in 1xTBS with 0.5% Tween-20 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Microbiology 2023Quote: ... cell-based expression system and RBD proteins were purified using Protein A affinity resin (Genscript Cat#: L00210). Protein purities were assessed by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble protein fraction of cells expressing GST-tagged proteins was incubated with glutathione resin (GenScript; L00206) at 4°C for 1 h with constant rotation (10 rpm) ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Microbiology 2021Quote: ... Selected small proteins and small protein derived peptides from high-and medium observed abundance were chemically synthesized (Genscript) and subjected to LC-MS/MS as above ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Tmod3 amino acid sequence with locations of peptides (red – Nterm, blue - Cterm) used to custom prepare chicken anti-Tmod3 antibodies (Genscript). A commercial rabbit anti-Tmod3 antibody (Aviva ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...