Labshake search
Citations for GenScript :
1 - 50 of 612 citations for Mouse Anti Nipah Virus Glycoprotein F CG11 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Immunology 2022Quote: ... each T150 flasks was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg of pLAIΔEnv GFP or 2.5 μg packaging plasmid (p8.91 ...
-
bioRxiv - Microbiology 2020Quote: ... each T150 flask was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein encoding plasmid (pMDG) (Genscript), 2.5 μg of packaging plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: VLPs were produced by transfecting T150 flasks of HEK293T cells with 8μg of vesicular stomatitis virus-G glycoprotein (VSV-G) expressing plasmid pMDG (Genscript) pMDG ...
-
bioRxiv - Microbiology 2019Quote: ... For HIV-1 GFP/Luc each flask was transfected with 2.5 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 µg pLAIΔEnv GFP/Luc ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 spike glycoprotein expression constructs were synthesized by GenScript (Netherlands). Constructs bore the following mutations relative to the Wuhan-Hu-1 sequence (GenBank ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein B.1.1.529-Omicron (RP30121, GenScript Biotecn Corp, Piscataway, NJ) were used with the simultaneous control of the wild-type ...
-
bioRxiv - Microbiology 2023Quote: ... Dabie Bandavirus (DBV) glycoprotein Gn gene (GenBank NC_018138.1) was codon-optimized for human codon usage (Genscript) and cloned into the expression vector ...
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: EAE was induced by injection of 200 μg of myelin oligodendrocyte glycoprotein epitope MOG35-55 (#RP10245, Genscript) emulsified in complete Freund’s adjuvant (CFA ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 S glycoprotein ectodomain (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) were cloned into pcDNA3.1+ plasmid by GenScript with the host N-terminal signal peptide sequence ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-V5 (Genscript); 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GST (GenScript ; #A00865) and mouse anti-V5 (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... For LAI WT each flask was transfected with 2.5 μg of VSV-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg pLAIΔEnvGFP (Suppl ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Immunology 2020Quote: Full-length human codon-optimized SARS-CoV-2 Spike (S) glycoprotein (NC_045512.2) in pUC57 was obtained from GenScript (MC_0101081). The plasmid was used as a PCR template to generate a cDNA encoding SARS-CoV-2 Spike with a deletion in the nucleotides encoding the C-terminal 19 amino acids (S-Δ19CT ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized cDNA encoding the SARS-CoV-2 S1 domain fused to the C-terminal portion of the VSV glycoprotein was obtained from Genscript. The cDNA was cloned into the XhoI and NheI sites of a modified recombinant VSV vector containing an additional transcription start stop signal between the G and L genes (Wirblich et al. ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... An emulsion of the Myelin Oligodendrocyte Glycoprotein (MOG35-55 peptide, 250 µg in a final volume of 200 µl: GenScript) and complete Freund’s adjuvant (CFA ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Plant Biology 2022Quote: ... mouse anti-Flag (A00187, GenScript, Piscataway, NJ), rabbit anti-histone H3 (A01502 ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... plenti CRISPR v2 virus against sgRNA targeting c-MYC (Genscript) and plenti CRISPR v2 virus (control ...
-
bioRxiv - Immunology 2020Quote: aEAE was induced in C57Bl/6j mice and in iNOS-tdTomato × Arginase-YFP and CX3CR1-GFP × CCR2-RFP mice by injection of myelin oligodendrocyte glycoprotein peptide 35-55 (MOG35-55 peptide, 200 μg per animal, Genscript, USA) and complete Freund’s adjuvant (Incomplete Freund’s Adjuvant ...
-
bioRxiv - Immunology 2021Quote: EAE was induced in 8-week-old mice by subcutaneous immunization with 100 μg myelin oligodendrocyte glycoprotein (MOG35-55) peptide (GenScript Biotech) emulsified in complete Freund’s adjuvant (CFA ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-RHDV RdRp was prepared by Genscript and stored in our laboratory ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse and rabbit anti-six histidine tag (Genscript, Nanjing ...
-
bioRxiv - Genetics 2021Quote: ... We followed up with Mouse anti His6 (Genscript), rabbit anti-HA-PE (Cell Signaling Technology) ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti FLAG-tag (1:500; A00187, GenScript). Anti-rabbit and anti-mouse secondary antibodies coupled to Alexa-488 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...