Labshake search
Citations for GenScript :
1 - 50 of 354 citations for Mouse 20S Proteasome 20S PSM CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: N-terminally formylated PSM peptides (> 95% purity) were purchased from GenScript Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... BDNF 20 ng/mL (GenScript), GDNF 20 ng/mL (GenScript) ...
-
bioRxiv - Neuroscience 2023Quote: ... GDNF 20 ng/mL (GenScript), 200 μМ ascorbic acid (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... or TNFα (GenScript, Z02774-20). Human GF was treated with five cholesterol-lowering drugs (fenofibrate ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs of GALNTs 1-20 (Genscript) were amplified by PCR and digested by BamHI and NotI (GALNT1 ...
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... 20-minute washes with 33 ul of GluA1 peptide (20 ug/ul) representing the antibody epitope (GenScript Biotech, Piscataway, NJ). ATVs were then immediately used and continually stored on ice at 4 °C.
-
bioRxiv - Biophysics 2021Quote: ... 20 mg/mL Nb35 and 10 μM peptide (GenScript). The lysate was incubated for 1.5 h at room temperature (RT ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The bioluminescence detection signal was measured for each design lucCage at 20 nM mixed with lucKey at 20 nM in the presence or absence of 100 nM cardiac Troponin I (Genscript, Cat. No. Z03320-50). Subsequently ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... Immunoblotting was performed as reported (20) using anti-His (GenScript) or anti-carrot FBA (14 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... splenocytes were cultured with E61-20 peptide (0.05 μg / mL, GenScript) in round-bottomed 96 well plates (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Biochemistry 2019Quote: ... 26S proteasome was eluted with 26S lysis buffer + 0.5 mg/mL 3X FLAG peptide (Genscript). FLAG eluate was cleaved with HRV protease added in excess ...
-
bioRxiv - Bioengineering 2021Quote: ... The mixtures were subsequently separated by 4–20% SDS-PAGE Gel (GenScript) and transferred to poly-vinylidene fluoride (PVDF ...
-
bioRxiv - Biochemistry 2020Quote: ... Extracted proteins were separated in 4-20% precast gradient PAGE gels (Genscript) and transferred to PVDF membranes for immunoblot ...
-
bioRxiv - Biochemistry 2022Quote: ... using SurePAGE 4-20% gradient Bis-Tris gels (Genscript, Picastaway, NJ, USA) under reducing conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides (20 μg) were immobilized on pre-washed streptavidin magnetic beads (Genscript) in TBS with 1 % BSA for 1 h at RT before washes in TBS to get rid of unbound peptides and resuspension in extract buffer without NaCl in order to get a final molarity of 110 mM NaCl for the pulldown ...
-
bioRxiv - Immunology 2022Quote: ... at 20 mg/ml were mixed with the fusion peptide (KPSKRSFIEDLLFNK, GenScript) at 20 mM and incubated for 2 h at room temperature before setting up crystallization plates ...
-
bioRxiv - Microbiology 2019Quote: ... samples were loaded onto ExpressPlus 4-20% PAGE gels (Genscript; Piscataway, NJ) and run under denaturing conditions ...
-
bioRxiv - Bioengineering 2023Quote: Protein samples were separated at 150 V in 4% - 20% SurePage (Genscript) polyacrylamide gels using MOPS-SDS running buffer and 1x NuPAGE LDS sample buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded on Bis-Tris gradient gels (4-20%, Genscript) and run using Tris-MOPS buffer at 60 mA/200 V ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell lysates were separated by 4-20% SDS-PAGE (GenScript M00657) and transferred to a nitrocellulose membrane (0.45 µm ...
-
bioRxiv - Biochemistry 2020Quote: ... SDS-PAGE analysis was performed on precast 4-20% gradient gels (GenScript, USA) in a Tris-MOPS buffered system under reducing conditions according to manufacturer guidelines ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The extracts were fractionated on a 4-20% ExpressPlus™ PAGE gel (Genscript) using SDS-MOPS buffer and transferred onto nitrocellulose membrane (BioTrace™ NT Nitrocellulose transfer membrane ...
-
bioRxiv - Immunology 2022Quote: ... 55 μM β-mercaptoethanol) supplemented with 20 μg/mL MOG35-55 peptide (GenScript), 20 ng/mL IL-12 (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-cast gradient gels (4-20 %) were purchased from GenScript (Piscataway, NJ). Electrophoresis was performed using a Bio-Rad SDS-PAGE gel analysis casting system (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was directly loaded on the 4-20% SDS-PAGE gel (GenScript) following addition of 4× laemmli loading buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were visualized by SDS-PAGE (4-20% gradient gel, Sure Page Gels, GenScript), and band intensity was determined using Image Lab (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the 1.0x co-cultures were assessed with supplementation of 20 µM ɑ-factor (GenScript). Yeast was pre-cultivated in 0.5 mL SC (24 hrs. ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.