Labshake search
Citations for GenScript :
1 - 50 of 1183 citations for Human Single stranded DNA binding protein 4 SSBP4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... A single-stranded DNA repair construct (synthesized by Genscript) with the sequence 5’- CTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATGCAGA ATTCCGACATGATTCAGGATATGAAGTCCATCATCAAAAACTGGTAGGCAAAAATAAACTGCCTCTCCCCGAGATTGCGTCTGGCCAGATGAAAT-3’ was used to introduce the G601R ...
-
bioRxiv - Synthetic Biology 2021Quote: ... research grade long single-stranded DNA was manufactured at large scale by Genscript Biotech via a proprietary isothermal enzymatic reaction process (PCT/CN2019/128948) ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... we outsourced purified recombinant human RHINO protein from GenScript. Rhno1 cDNA with N-terminal 6xHIS tag and TEV cleavage sequence was cloned into a pET30a vector and expressed in E ...
-
bioRxiv - Plant Biology 2021Quote: ... The DNA sequences of the single aMIRNA genes were chemically synthesized by GenScript® (GenParts™ Synthesis service ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein sequences were human codon-optimized using online tools (GenScript), synthesized as gene blocks (IDT) ...
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Microbiology 2021Quote: ... RBD-binding peptide SBP1 derived from human ACE2 α helix 1 (Ac-IEEQAKTFLDKFNHEAEDLFYQS-NH2) was synthesized by GenScript (Nanjing, China).
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant Hsc70-4 protein was produced by GenScript by expression of the recombinant protein with a 6X His tag in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript) at 0.1 µg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... the cells were spun down at 4000 g for 30 min at 4 °C and GLA protein was purified by batch binding with 2.5 mL of Anti-DYKDDDDK G1 Affinity Resin (L00432, Genscript) in the harvested and 0.8 μm filtered supernatant ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: A codon optimised DNA encoding human USP28 was procured from Genscript and cloned between the NdeI/BamHI multiple cloning site (MCS ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Wild type or a mutant version of the human PDX1 enhancer with 6 CisBP predicted RFX binding motifs mutated (Weirach et al 2014) were commercially synthesized by Genscript (Genscript USA, Piscataway, NJ) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Biochemistry 2020Quote: ... Extracted proteins were separated in 4-20% precast gradient PAGE gels (Genscript) and transferred to PVDF membranes for immunoblot ...
-
bioRxiv - Bioengineering 2023Quote: Protein samples were separated at 150 V in 4% - 20% SurePage (Genscript) polyacrylamide gels using MOPS-SDS running buffer and 1x NuPAGE LDS sample buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were resolved in an ExpressPlus 4-12% gradient gel (GenScript), electroblotted to a nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Bioengineering 2022Quote: Both collagen binding peptide (CBP, sequence: CNNNLHLERL, Genscript) and scrambled sequence peptide (SCR ...
-
bioRxiv - Biochemistry 2022Quote: ... The DNA encoding this fusion protein was commercially synthesized (GenScript Inc) and cloned into pET15b bacterial expression vector at Nco I/BamH I cloning sites ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... double-stranded GBS-optimized sgRNA cassette (Genscript custom order) with an upstream xyl/tet promoter that constitutively expresses the sgRNA ...