Labshake search
Citations for GenScript :
1 - 50 of 524 citations for Human Histone H3.3C H3 5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... rabbit anti-histone H3 (A01502, GenScript), and rabbit anti-PEPC (100-4163 ...
-
bioRxiv - Biochemistry 2022Quote: ... and polyclonal anti-histone H3 (A01502, GenScript, Piscataway, NJ). After washing three times with TBST buffer ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: Antibodies obtained from commercial sources were as following: β-actin and Histone H3 from Genscript, Ku86 (C-20 ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-total H3 (GenScript, 2.5 µL), anti-H3K4me2 (Millipore 07-030 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and K193R (H3 numbering) was ordered from GenScript and inserted into the HA of A/chicken/Germany/R28/2003 in a pHWSccdB vector by restriction enzyme cloning ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Biophysics 2022Quote: All the unmodified and acetylated histone peptides were purchased from GenScript (Piscataway, NJ, USA). The synthesized peptides were purified by HPLC to achieve 98% purity and present in lyophilized form with TFA salt ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Chemical shift perturbation experiments were performed by obtaining HSQC spectra with increasing concentrations of histone tail peptides (GenScript) up to 1:5 molar ratio of PHD1:peptide ...
-
bioRxiv - Biochemistry 2021Quote: The cDNAs encoding for human ASGR1 and human ASGR2 were obtained from GenScript (NJ). Human ASGR1 and its mutants (Q240A/W244A and Q240A/W244A/E253A ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Biochemistry 2024Quote: The full-length cDNAs for human SIDT1 and human SIDT2 were synthesized by Genscript Company (SIDT1 ...
-
bioRxiv - Cancer Biology 2023Quote: MSH2-MSH6: Human MSH2 and human MSH6-GFP were synthesized into pFASTBac1 constructs (GenScript) and were co-infected into Sf9 insect cells for expression ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... residues A27-T157), human FZD7 CRD (UniProt: O75084, residues Q33-G170), human FZD8 CRD (UniProt: Q9H461, residues A28-T158) were synthesized (Genscript). Human LRP6 P1E1P2E2 (UniProt ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-human IgG peroxidase conjugated (A00166, GenScript, USA) or anti-mouse IgG peroxidase conjugated (A4416 ...
-
bioRxiv - Cancer Biology 2022Quote: ... murine and human CD20 cDNA expression constructs (GenScript) were transiently transfected into 293T cells using lipofectamine (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2022Quote: The H3F3A and H3F3B human cDNA sequences (GenScript) were cloned by using ClaI and EcoRI restriction enzymes into the pSNAPm plasmid (New England Biolabs) ...
-
bioRxiv - Biophysics 2022Quote: The human PEAK3 gene was synthesized by GenScript and subcloned into the pcDNA4/TO vector with a C-terminal 3xFLAG tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human SENP1 cDNA (ENST00000448372.5) was synthesised by GenScript to contain an N terminal FLAG tag and synonymous siRNA resistance mutations to the exon 6 and 12 siRNA used (see table 1) ...
-
bioRxiv - Biophysics 2022Quote: The gene that encodes human SERINC3 (Genscript-OHu02717D) was inserted upstream of a thrombin protease cleavable linker (LVPRGS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was gene-synthesized (by Genscript) and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Microbiology 2019Quote: ... The human TRIM34 cDNA was purchased from Genscript (NM_001003827.1). Human TRIM34 was cloned into pHIV/dTomato using NotI and XmaI sites with an HA tag encoded at the N-terminus ...