Labshake search
Citations for GenScript :
1 - 50 of 410 citations for EGFR Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Cancer Biology 2023Quote: ... as well as human EGFR (GenScript, Piscataway, NJ; Cat# Z03194) as a control surface ...
-
bioRxiv - Cell Biology 2022Quote: Human His-CLASP1 (NM_015282.2) in pFastBacHT vector was purchased from Genscript. The cDNA encoding full-length human CLASP2α was purchased from Dharmacon (Accession ...
-
bioRxiv - Bioengineering 2021Quote: ... 843 RUs of SARS-CoV-2 RBD/SD1 fused to human Fc (RBD/SD1-Fc) and 972 RUs of EGFR (Genscript, Piscataway ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Bioengineering 2024Quote: ... iFluor 647-conjugated anti-His-tag antibody (pilot CYpHER detection and TfR human/mouse cross-reactivity, Genscript A01802); Alexa Fluor 647-conjugated anti-Fc Fab (Surface protein and CYpHER quantitation ...
-
bioRxiv - Microbiology 2020Quote: ... 50 ng of His-tagged RBD (His-RBD, aa 319-541) (Genscript) was then added to each well and incubated at 37°C for 2 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-His tag (Genscript) or anti-FLAG (Genscript ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminally His-tagged construct encoding human UGGT1 residues 43-1551 was PCR-amplified from the commercially sourced vector UGGT1-pUC57 (GenScript) with primers ...
-
bioRxiv - Immunology 2022Quote: For immunoprecipitation, 10×106 human peripheral blood monocytes cells were treated with SARS-CoV-2 Spike protein (RBD, His Tag) (GenScript) 100 ng/ml for 2 hours ...
-
bioRxiv - Biophysics 2022Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript. C0-C2 mutants were engineered using a Q5 Site-Directed Mutagenesis Kit (New England Bio Labs) ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Immunology 2022Quote: His tag-IP was performed using anti-His affinity resin (GenScript L00439-1) and Myc tag-IP was performed using anti-Myc affinity resin ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-His-HRP (Genscript, A00612), Avidin-HRP (Biolegend ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged Enterokinase (Z03004, Genscript) was added to the dialyzed ...
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Microbiology 2021Quote: ... His-tagged AtxA was detected using anti-His antibody (GenScript USA Inc., Piscataway, NJ, USA). RNA polymerase subunit β was used as a loading control and detected using anti-RNAP antibody (Thermo fisher ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Microbiology 2020Quote: ... THE™ Anti-His-HRP (Genscript).
-
bioRxiv - Plant Biology 2023Quote: ... Hexa-His peptide (Genscript, Inc., NJ) was used as a control ...
-
bioRxiv - Microbiology 2023Quote: ... An unconjugated Anti-HIS antibody (Genscript) was added (5.0 mg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... The pESC-HIS-hMfsd7c plasmid (Genscript) was used for overexpression on the yeast S ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Plant Biology 2019Quote: ... HIS-TAN1 and HIS-TAN1-GFP concentrations were checked with a BCA protein assay (Genscript Corp Piscataway, New Jersey USA). After refolding ...
-
bioRxiv - Synthetic Biology 2022Quote: ... linker with both N-terminal and C-terminal 10×His-tags with a cysteine adjacent to each 10×His tag in a pET21b vector (Genscript). The plasmid was transformed into T7 express cells (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The successful removal of His-tag was validated by western blot using the anti-His-tag antibody (Genscript, A00186-100).
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biophysics 2020Quote: ... To determine the binding affinities between antigens and antibody mouse monoclonal anti-His-tag IgG (clone 6G2A9, The™ His tag Ab, GenScript) was captured on the surface of active flow cell to the level of 100-200 RU ...
-
bioRxiv - Biochemistry 2023Quote: ... Equilibrated Ni-NTA resin was added to the products to bind the MBP-His tag and the His-tagged TEV protease (Genscript, Cat. # Z03030) while allowing the purified FAM210A-dMTS cleaved product to be collected in the flowthrough ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1:200 iFluor647-conjugated mouse anti-His (Genscript A01802) for civet ACE2 ...
-
bioRxiv - Biochemistry 2020Quote: ... and Western blot analysis using anti-His (A01620, Genscript) and anti-PSA-NCAM (MAB5324 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the mouse anti-His (A00186, GenScript, 1:5000 diluted), and the rabbit anti-HA (902303 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Untagged ANXA1 was isolated by His-tagged enterokinase (Genscript) treatment followed by Ni-affinity chromatography ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...