Labshake search
Citations for GenScript :
1 - 50 of 306 citations for EGFR Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 843 RUs of SARS-CoV-2 RBD/SD1 fused to human Fc (RBD/SD1-Fc) and 972 RUs of EGFR (Genscript, Piscataway ...
-
bioRxiv - Molecular Biology 2022Quote: IgGFc: Human IgG Fc Sequence (Supplementary Material Figure S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Cancer Biology 2023Quote: ... as well as human EGFR (GenScript, Piscataway, NJ; Cat# Z03194) as a control surface ...
-
bioRxiv - Immunology 2020Quote: Recombinant human ACE2-Fc (Genscript) at concentration of 2 μg/ml in phosphate buffer saline (PBS ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Biophysics 2020Quote: ... The codon optimized genes were synthesized for expression in human epithelium kidney cells (HEK293) (GenScript, Piscataway, NJ, USA), but were also found to prone to recombination upon insertion into pCDNA3.1 ...
-
bioRxiv - Molecular Biology 2022Quote: MFcS2: Modified human ACE2 (Sequence-Supplementary Material S1) was codon optimized for HEK293 expression and synthesized from Genscript USA in pUC57 vector ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2021Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Immunology 2022Quote: ... nanobodies containing human IgG1 Fc in the culture supernatant were captured by AmMag Protein A Magnetic Beads (Genscript L00695) and eluted by Glycine pH 3.0 ...
-
bioRxiv - Immunology 2022Quote: ... and subcloned into an expression vector containing the human IgG1 or IgA1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into CHO cells ...
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Immunology 2024Quote: Cognate VH and VL antibody sequences of interest were synthesized and cloned into a customized pcDNA 3.4 vector containing a human IgG1 Fc region by GenScript Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Immunology 2020Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
bioRxiv - Microbiology 2021Quote: ... hACE2-Fc was synthesized and cloned by GenScript with a BM40 signal peptide ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... Neuro-2a cells or HEK293 cells were transiently transfected with pcDNA3.1(+)-C-DYK-mLRP1 (mouse LRP1 CDS; NM_008512.2, Genscript) and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies (anti-FLAG M2; Sigma and chimeric ACE2-Fc (Genscript; Z03484) were diluted in PBS-BSA to 1 μg mL−1 and added to each imaging dish ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Biochemistry 2021Quote: ... Human EPCR cDNA (Genscript) was PCR amplified and cloned in frame with a GP64 signal peptide in a pAcGP67A transfer vector ...
-
bioRxiv - Immunology 2020Quote: ... and the S1-Receptor Binding Domain (S1-RBD; Cat. No Z03483; expressed in HEK293 cells) were purchased from by GenScript. The S1-N-terminal domain (S1-NTD ...
-
bioRxiv - Molecular Biology 2020Quote: ... The donor sequence with 700 bp homology arms on each side of the insert site was designed based on the HEK293 reference genome52 and synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biochemistry 2021Quote: The cDNAs encoding for human ASGR1 and human ASGR2 were obtained from GenScript (NJ). Human ASGR1 and its mutants (Q240A/W244A and Q240A/W244A/E253A ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Biochemistry 2024Quote: The full-length cDNAs for human SIDT1 and human SIDT2 were synthesized by Genscript Company (SIDT1 ...
-
bioRxiv - Cancer Biology 2023Quote: MSH2-MSH6: Human MSH2 and human MSH6-GFP were synthesized into pFASTBac1 constructs (GenScript) and were co-infected into Sf9 insect cells for expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... human IL11 (hIL11, Z03108, Genscript), mouse IL11 (mIL11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human AMPKγ3 (GenScript, NJ, USA) and mouse AMPKγ3 (Yenzym ...
-
bioRxiv - Biophysics 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Bioengineering 2021Quote: Codon-optimized genes for bivalent VHH-Fcs were synthesized and cloned into pTT5 (GenScript; Piscataway ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The sequences containing 7F9-Fc cDNA were custom synthesized and ligated into pUC57 (GenScript). Plasmids containing 7F9-Fc were transformed into Invitrogen Top10F competent cells (Thermo #C303003 ...
-
bioRxiv - Immunology 2020Quote: ACE2-Fc expression vector was generated by subcloning a gene-synthesized cDNA template (GenScript) encoding soluble human ACE2 (amino acid residue 1-738 ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Cell Biology 2021Quote: Codon optimized human SHIP164 generated by Genscript was amplified using PCR from the pUC57 plasmid and ligated into various mammalian and bacterial expression plasmids ...
-
bioRxiv - Neuroscience 2022Quote: Human Stathmin expression clones were from Genscript (STMN1-OHu14092D ...
-
bioRxiv - Biophysics 2022Quote: Isoform 1 of human SERINC2 (GenScript-OHu23082D) was cloned into pFastBacI with the TEV and STREP cleavage and affinity tags upstream of the gene encoding hSERINC2 ...
-
bioRxiv - Microbiology 2021Quote: ... ECD or those with desired ACE2 mutations were fused to the codon-optimized synthetic IgG1 Fc (GenScript) in which GASDALIE or LALA mutations were incorporated ...