Labshake search
Citations for GenScript :
1 - 50 of 152 citations for Dengue Virus Serotype 3 VLP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Biochemistry 2022Quote: ... Uniprot identifier C3LP26) and Vibrio cholerae serotype O1 (strain M66-2) FeoB (Uniprot identifier C3LP27) were synthesized by GenScript. Materials used for buffer preparation ...
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... The GII.4 Sydney 2012 variant specific-mAbs (1C10, 6E6, 17A5, and 18G12) were developed from mice immunized with RockvilleD1 strain VLP (GenScript, NJ, USA). HBGA-blocking assays were performed using mutant and wild-type VLPs ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Cancer Biology 2022Quote: ... plenti CRISPR v2 virus against sgRNA targeting c-MYC (Genscript) and plenti CRISPR v2 virus (control ...
-
bioRxiv - Immunology 2022Quote: ... with virus from LVX-PD1-mNeonGreen lentiviral vector (synthesized by GenScript) and cultured in RPMI1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2022Quote: ... with virus from pLVX-PDL1-mScarlet lentiviral vector (synthesized by GenScript) and cultured in F12 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... which was performed using the SARS2 surrogate virus neutralization test (Genscript, Piscataway, NJ). Thirteen days after the boost ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit from GenScript (REF: L00847) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and 1 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Both plasmid cloning and BacMam virus generation were done by GenScript (Nanjing, China).
-
bioRxiv - Immunology 2021Quote: ... All Neutralization assays were performed with the surrogate virus neutralization test (sVNT) (GenScript, USA), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: The SARS-CoV-2 surrogate virus neutralization test (sVNT) kit was obtained from GenScript Inc ...
-
bioRxiv - Microbiology 2023Quote: ... The gene coding Tobacco Etch Virus (TEV) protease was synthesized (Genscript Biotech B.V., Netherlands), then amplified by PCR using primers P1177 and P1178 and cloned into the EcoRV linearized pHYX137 by IVA in E ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Immunology 2021Quote: Neutralizing antibodies were measured using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript). Hamster sera was diluted from 1:20 to 1:500 incubated at a 1:1 ratio with HRP conjugated SARS-CoV-2 RBD protein for 30 min at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Immunology 2022Quote: ... each T150 flasks was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg of pLAIΔEnv GFP or 2.5 μg packaging plasmid (p8.91 ...
-
bioRxiv - Microbiology 2020Quote: ... each T150 flask was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein encoding plasmid (pMDG) (Genscript), 2.5 μg of packaging plasmid ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Molecular Biology 2021Quote: VLPs were produced by transfecting T150 flasks of HEK293T cells with 8μg of vesicular stomatitis virus-G glycoprotein (VSV-G) expressing plasmid pMDG (Genscript) pMDG ...
-
bioRxiv - Microbiology 2019Quote: ... For HIV-1 GFP/Luc each flask was transfected with 2.5 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 µg pLAIΔEnv GFP/Luc ...
-
bioRxiv - Biochemistry 2021Quote: RBD-ACE2 binding competition assay was developed using the SARS-CoV-2 surrogate virus neutralization test kit (Genscript, NJ). First a 5-fold dilution series of RBD variant starting at 10 μM was prepared in sample dilution buffer in duplicate ...
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Influenza virus hemagglutinin (A/New Yotk/392/2004, NCBI accession # YP_308839) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pfs25 was expressed and purified from a baculovirus expression system using Spodoptera frugiperda SF9 cells and P2 virus by Genscript.
-
bioRxiv - Immunology 2022Quote: The neutralizing activity of mouse serum samples was detected by SARS-CoV-2 Surrogate Virus Neutralization Test Kit (L00847A, GenScript). Detections were performed according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: The codon-optimized sequences for the three subunits of avian influenza A/Goose/Guangdong/1/1996 (H5N1) virus polymerases were synthesized (GenScript) and cloned into pFastBac expression plasmid for polymerase expression and structure determination ...
-
bioRxiv - Biochemistry 2022Quote: ... a linker region (DYDIPTT) and a Tobacco Etch Virus (TEV) protease site (ENLYFQG) in a pET-22b vector were purchased from Genscript. Site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... The codon-optimized gene encoding for these residues plus an engineered DNA sequence encoding for a C-terminal tobacco etch virus (TEV)-protease cleavage site (ENLYFQS) was synthesized by GenScript. This gene was then subcloned into the ampicillin-resistant ...
-
bioRxiv - Immunology 2020Quote: A full-length nucleocapsid (N) phosphoprotein nucleotide sequence (1293 base-pairs) of the SARS-CoV-2 virus was optimized and synthesized (Genscript). The synthesized sequence was cloned into a PET-30a(+ ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2020Quote: ... A second serum aliquot was tested with a surrogate virus neutralization test that detects isotype-independent RBD neutralizing antibodies (cPass, GenScript) (18) ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized in pcc1-pbrick plasmid between cauliflower mosaic virus promoter (CaMV) 35S promoter and CaMV PolyA terminator de novo by GenScript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Biochemistry 2024Quote: ... and synthesized and cloned into the pET-DUET-1 vector with a C-terminal Tobacco Etch Virus (TEV) protease cleavage site (ENLYFQG) and hexahistidine tag (His6) (GenScript). The expression construct was transfected into E ...
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Molecular Biology 2020Quote: ... vector containing DENV2C protein gene sequence with N-terminal His tag and Tobacco Etch Virus (TEV) digestion site was purchased from GenScript (China). Recombinant capsid protein from DENV2 NGC strain was expressed in Escherichia coli BL21 strain ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Neutralizing antibodies against the SARS-CoV-2 in hamster blood plasma were determined using the “SARS-CoV-2 Surrogate Virus Neutralization test kit” (GenScript, USA).
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...