Labshake search
Citations for GenScript :
1 - 50 of 1193 citations for Chitinase 3 Like Protein 2 CHI3L2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... SMT (SUMO-like tag) fusion protein in a pET28a vector (Genscript). Quick Change mutagenesis was performed to generate the W611A mutant of hP13 ZnF5-WWE1-WWE2 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biochemistry 2020Quote: ... ZmGl2-like sequence was initially obtained from GenScript as a pUC57-clone and was sub-cloned into pENTRTM/D-TOPO® entry vector (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the mutated uricase-like coding sequence was synthesized by Genscript (USA Inc.) into a pET28 expression vector ...
-
bioRxiv - Immunology 2021Quote: Purified SARS-CoV-2 S1 protein (GenScript) in carbonate buffer ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Microbiology 2020Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Physiology 2021Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Purified EGF-like domain of NRG1β was incubated with G1 Flag Resin (Genscript) for 1 hr at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2022Quote: The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse like-acetylglucosaminyltransferase-1 (Large1) was synthesized (Genscript, Piscataway, NJ) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter (gift from Jeff Chamberlain) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the uricase-like coding sequence (XM_015290876.2) of LOC101747367 was synthesized by Genscript (USA Inc.) into pcDNA3.1+/ C-(K)DYK standard vector ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Molecular Biology 2023Quote: ... basic coil motif (AQCKKKLQALKKKNAQLKWKLQALKKKLAQ) and 6xHIS tag inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The region encoding the α4 ectodomain (M1-Q970 ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were purified with Protein A magnetic beads (GenScript, L00273). Expression vectors for CoV-2196 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Immunology 2020Quote: ... Commercial antibodies tested also included a human IgG chimeric antibody from GenScript (SARS-CoV-2 spike S1 Antibody (HC2001), GenScript #A02038 ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... GO grids were first incubated with 3 µL of 250 nM recombinant protein G (Genscript Z02007) in resuspension buffer ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the truncated version of Npnt containing only the N-terminal EGF-like repeats domain (Npnt-EGF) were commercially synthesized (Genscript) and cloned into the modified RCAS vector ...
-
bioRxiv - Biochemistry 2020Quote: The selected LDKA-like peptides were synthesized using standard Fmoc chemistry and purified to 98% purity using reverse phase HPLC by GenScript, Inc (Piscataway ...
-
bioRxiv - Biochemistry 2024Quote: ... Purified EGF-like domain of NRG1ý or BTC was incubated with anti-DYKDDDDK G1 affinity resin (Genscript, short anti-Flag) for 1 hour at 4 °C and serially washed 3x with Buffer A (50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified protein was used for raising polyclonal antibodies in rabbits (Genscript). Optimal detection of SAP05 in phytoplasma-infected plants occurred at a 1:2,000 dilution of the antibody ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.