Labshake search
Citations for GenScript :
1 - 50 of 563 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... VHA was immunodetected using custom-made rabbit polyclonal antibodies against a highly conserved epitope within subunit B (epitope: AREEVPGRRGFPGY; GenScript, Piscataway, USA). Both NKA and VHA antibodies have been validated in the inner ear of splitnose rockfish (24 ...
-
bioRxiv - Biochemistry 2021Quote: The construct for the yeast Rev1 catalytic core was purchased from GenScript. All Rev1 constructs were transformed and expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... and Delta (B.1.617.2) — were synthesized and cloned into pcDNA3.1 vector using KpnI/BamHI restriction enzyme cloning by GenScript BioTech (Piscataway ...
-
bioRxiv - Molecular Biology 2021Quote: ... Constructs encoding USP21 catalytic domain with GS linker were made by GenScript (Nanjing, CN). Genes encoding WT mouse MLKL and PCR-derived mutants were cloned into pF TRE3G PGK puro ...
-
bioRxiv - Developmental Biology 2023Quote: ... or b) mRNA of either mCherry or GFP at 400ng/µl and ribonucleoprotein formed by Cas13a (GenScript, Piscataway, NJ) at 400 ng/µl and the corresponding targeting sgRNA at 400 ng/µl ...
-
bioRxiv - Cell Biology 2022Quote: ... The primary antibody against Ft-L was made using recombinant human Ft-L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Physiology 2021Quote: ... whereas the β-subunit of VHA was immunodetected using a custom-made polyclonal rabbit antibody (epitope: AREEVPGRRGFPGYC; GenScript, Piscataway, USA). These antibodies have been previously used in the inner ear of the Pacific chub mackerel (Scomber japonicus ...
-
bioRxiv - Molecular Biology 2023Quote: ... Endogenous CRISPR-based editing vector pNZ624 was obtained by ligation of artificial crRNA synthesized from GenScript and NspI-digested pNZ123 ...
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DROSHA knockout cell lines used were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and pcDNA3.1 Flag-tagged MCM subunits (ORF cDNA clones from Genscript). After 48 h ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Molecular Biology 2019Quote: ... The TSEN34 (Y247A, H255A, K286A) and TSEN2 (Y369A, H377A, K416A) catalytic mutant co-expression plasmid was generated by Genscript. Please refer to Table S1 for a list of all expression plasmids used in this study ...
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Immunology 2021Quote: ... and S1 subunit (0.5 µg/mL) (cat n° Z03501, GenScript, Piscataway, NJ, USA) purified recombinant proteins dissolved in carbonate-bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2022Quote: ... Delta (B.1.617.2) and Omicron (B.1.1.529) were synthesized by GenScript. The production of SARS-CoV-2 S pseudotyped vesicular stomatitis virus (VSV ...
-
bioRxiv - Cell Biology 2022Quote: Three subunits of the human mTORC1 complex (mTOR, Raptor, mLST8) were codon-optimized and synthesized (GenScript). The mTOR gene was cloned into a pCAG vector without a tag ...
-
bioRxiv - Biochemistry 2024Quote: Subunit specific fluorogenic substrates were custom synthesized and purified by HPLC to >95% by GenScript (New Jersey). Substrates contained either an N-terminal acetylation group and a C-terminal amc group ...
-
bioRxiv - Cell Biology 2022Quote: ... ferritin L (Ft-L) made by using purified human ferritin L subunit as antigen by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Synthetic Biology 2021Quote: All gBlocks fragment containing 5 sgRNA expression cassettes with high fidelity four-base overhang pair2 after cutting with type IIS restriction enzyme BbsI restriction enzyme were designed and directly sent to be synthesized into PUC57 cloning plasmid by GenScript. Two oligos with BbsI cutting sites were annealed and cloned into backbone vector with CMV promoter drive fluorescent protein expression using SpeI-HF ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1 ...
-
bioRxiv - Biochemistry 2021Quote: The codon-optimized sequences for the three subunits of avian influenza A/Goose/Guangdong/1/1996 (H5N1) virus polymerases were synthesized (GenScript) and cloned into pFastBac expression plasmid for polymerase expression and structure determination ...
-
bioRxiv - Cell Biology 2022Quote: Wild type prkar2b subunit of bovine PKA and mutant prkar2b (harbouring mutations that ablate all potential miR-34c seed sites) were synthesized (GenScript) and cloned into pmaxGFP vector (LONZA) ...
-
bioRxiv - Immunology 2022Quote: ... synthesized and cloned into an mRNA production plasmid (GenScript) as described[46] ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA of DNase1L3 and GC-DNase were synthesized by GenScript, LNP encapsulation of mRNA is performed by Nuohai Life Science (Shanghai ...
-
bioRxiv - Cell Biology 2022Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701). The construction of fluorescently tagged nAChR subunits were described previously [58 ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701), as previously described 17 ...
-
bioRxiv - Immunology 2021Quote: ... The B.1.429 RBD gene was synthesized by GenScript into pCMVR with the same boundaries and construct details with a mutation at L452R ...
-
bioRxiv - Evolutionary Biology 2019Quote: The miRNA precursors were synthesized with flanking restriction enzyme sites (GenScript) and cloned between the double Cauliflower mosaic virus (CaMV ...
-
bioRxiv - Microbiology 2020Quote: ... coli DHFR enzyme (FolA) was custom purified by Genscript (Piscataway, NJ). The enzymatic activity of DHFR with and without SCH-79797 treatment was measured using the Dihydrofolate Reductase Assay kit from Sigma ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... restriction enzymes) was synthesized into a pUC57 plasmid DNA vector by Genscript®.
-
bioRxiv - Immunology 2021Quote: ... the E subgenomic mRNA sequence was inserted into a pcDNA3.1 vector (Genscript) and transcribed using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.526 Spikes were codon-optimized and synthesized by Genscript. Plasmids encoding B.1.617 ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.351 spike cDNA was synthesized (Genscript, Piscataway, NJ, USA). Pseudoviruses were generated in BHK-21/WI-2 cells using a pseudotyped ΔG-GFP (G*ΔG-GFP ...
-
bioRxiv - Pathology 2020Quote: ... and flanking AscI restriction enzyme sites added in the pUC57 vector (GenScript, USA). These pUC57 vectors carrying the knock-in gene of interest were then single-pot cloned (with AscI ...
-
bioRxiv - Biochemistry 2020Quote: ... The gene for the ancestral enzyme HNL1 was synthesized by GenScript (Piscataway, NJ) and subcloned into a pET21a(+ ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Microbiology 2022Quote: ... mutant A and mutant B without signal peptides were synthesized by GenScript USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Full-length mRNA constructs in pcDNA3.1+/C-(K)DYK vectors were obtained from GenScript Biotech (Piscataway ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of clade B HIV-1JR-FL Env53 was codon optimized (GenScript) and cloned into expression plasmid pcDNA3.1(- ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified TopBP1b6-8 WT and W1145R were digested with PreScission 3C enzyme (GenScript, Z03092-500) for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: mRNA and gRNA were synthesized and packaged in LNP with ionizable lipid ALC0315 by Genscript. Briefly ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... 220 kDa ankyrin-B F131Q/F164Q (Wang et al., 2014) was created by Genscript by site-directed mutagenesis ...