Labshake search
Citations for GenScript :
1 - 50 of 604 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Protein G (5 μg/ml, 50 μl/well; Genscript, China, Z02007) was diluted to 5 μg/ml with PBS (0.01 M ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: FUS-CHOP type I and type II genes were synthesized by Genscript (Piscataway, NJ) and subcloned into pcDNA3-EGFP (Addgene 13031 ...
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Neuroscience 2023Quote: The wild-type construct was synthesized by Genscript Biotech by adding eGPF (accession JN204884.1) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg protein per sample were separated in 10% SDS gels (SurePAGE Bis-Tris gels, GenScript) for approximately 10 min at 120 V ...
-
bioRxiv - Genomics 2023Quote: ... plasmids containing wild type ORFs were obtained from GenScript. The ORFs were cloned into the pcDNA3.1(- ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The wild type AAV9 capsid gene sequence was synthesized (GenScript) with nucleotide changes at S448 (TCA to TCT ...
-
bioRxiv - Biophysics 2023Quote: ... and αS ΔNAC: Wild-type plasmids were synthesized from Genscript ® and the rest of the constructs were cloned at Florida State University ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Microbiology 2019Quote: ... PRV Us9 wild-type and mutant genes were synthesized (Genscript, Piscataway, NJ). The cellular gene Kif1A was PCR amplified from rat cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... wild-type and mutated deiChO-262 fragments were synthesized by GenScript (USA) and cloned into the reporter constructs placZattB (Table S4) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2021Quote: The synthetic gene encoding the BT_1526 ORF (wild type) was ordered from Genscript cloned into a pET-28a expression plasmid with a six-histidine tag at the N-terminus ...
-
bioRxiv - Microbiology 2023Quote: Sequential site-directed mutagenesis was performed using wild-type ALKBH1 plasmid (OHu05179, GenScript) as a template with the following primer pairs ...
-
bioRxiv - Biochemistry 2022Quote: The wild-type bovine MRP4 gene and the MRP4E1202Q mutant were synthesized by Genscript and cloned into pFastBac with a C-terminal thrombin-cleavable 8xHis tag ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Biophysics 2022Quote: The receptor constructs including wild-type CCR5 and all phosphosite mutants were synthesized from GenScript and subcloned in pcDNA3.1(+ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Biophysics 2023Quote: ... The gene encoding the wild-type hSOD1 of the native sequence was purchased from Genscript with E ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: Recombinant SARS-CoV-2 wild-type S protein RBD-HRP fusion protein (RBD-HRP protein, cat. no. Z03594) and hACE2 protein (cat. no. Z03516) were purchased from GenScript Korea Ltd ...
-
bioRxiv - Biochemistry 2021Quote: Wild-type USP14 and mutants were cloned into pGEX-4T vector obtained from GenScript (Nanjing, China). For purification of recombinant USP14 and mutants ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type OGG1 was expressed with a GST tag from a pGEX-6P1clone purchased from GenScript. The plasmid was transformed into T7 Express plysS Competent E ...
-
bioRxiv - Molecular Biology 2023Quote: The wild-type ASPA cDNA and selected variants studied in low throughput were generated by Genscript. The library cloning and barcoding described below are essentially as previously described 69 ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized human wild-type full-length (FL) APE1 in a pet28a vector was purchased from GenScript. The E96A/D210N ...
-
bioRxiv - Biophysics 2019Quote: Wild type rabbit skeletal regulatory light chain (RLC) insert (UniProtKB entry: MLRS_RABIT; P02608) was obtained from Genscript. Wild type chicken gizzard smooth muscle RLC (smRLC ...
-
bioRxiv - Microbiology 2021Quote: Both wild type and edited MARV NP 3’UTR coding sequences were synthesized by Genscript (Piscataway, NJ). For amplifying the remaining MARV UTRs purified total RNA from MARV infected THP1 cells at 24 hours post infection was used for cDNA synthesis ...
-
bioRxiv - Immunology 2022Quote: The spike – S1 peptide pools of Wuhan wild-type SAR-CoV2 were purchased from Genscript (cat # RP30027). The Peptivator peptide pools for the variant of concerns and B ...
-
bioRxiv - Microbiology 2023Quote: The codon-optimized sequence coding for the wild type (WT) N (stain Long) was syn-thetised (GenScript) and cloned in the pFastBac Dual vector under the control of the polyhedrin promoter at BamHI and SalI sites ...
-
bioRxiv - Biochemistry 2023Quote: The cDNA of wild-type PRKN or PRKN variants studied in low-throughput were purchased from Genscript. Single PRKN variants were integrated into the Tet-on landing pad in the HEK 293T TetBxb1BFPiCasp9 Clone 12 cell line ...
-
bioRxiv - Biochemistry 2023Quote: ... GNAI1 with the same flanking restriction sites was amplified from a wild type clone (Genscript, clone OHu13586) and from a designed codon harmonized (80 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Immunology 2020Quote: ... S1 and N proteins (Genscript) were conjugated onto MagPlex microsphere (Luminex ...