Labshake search
Citations for GenScript :
1 - 50 of 50 citations for 8 16 Pyranthrenedione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Peak fractions were resolved on 8–16% SurePAGE Bis-Tris (GenScript) gels.
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were run on gradient pre-cast SDS polyacrylamide gels (8-16%, ExpressPlu, GenScript, M81610, Piscataway, USA) before being transferred to nitrocellulose membranes (0.45μm ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Neuroscience 2019Quote: ... Equal volumes of supernatants and pellets were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis on 8-16% Bis-Tris gels (Genscript) that subsequently were stained with Coomassie blue R-250 (Supplementary fig ...
-
bioRxiv - Microbiology 2023Quote: ... The number and size of cleavage products were assessed by visualization of protein bands on 8-16% SurePAGE precast gels (GenScript) using MES SDS running buffer (GenScript ...
-
bioRxiv - Microbiology 2019Quote: The synthetic XIP (ComS11-17; GLDWWSL) (8, 26) and the 18-CSP (ComC26-43; SGSLSTFFRLFNRSFTQA) (16) were synthesized by GenScript (GenScript Corporation, NJ, USA), both with an estimated purity of 98% (26) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8% surePAGE gels (GenScript) were used for electrophoresis and Immobilon-FL PVDF membranes (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... PDB 7RNJ (16)) and produced in house starting from synthetic DNA (Genscript). The human IgG-like bispecific CoV-X4042 was designed based on the variable regions of antibodies sd1.040 and rbd.042 in the CrossMAb format (25) ...
-
bioRxiv - Molecular Biology 2024Quote: ... ancX-16 were codon optimized for Saccharomyces cerevisiae and synthesis by Genscript, China ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids for the other 16 TTSPs and furin were purchased from GenScript and described earlier (13) ...
-
bioRxiv - Bioengineering 2023Quote: ... A pET29b expression plasmid encoding I53-50B.4PT1 16 was synthesized by GenScript using the NdeI and XhoI restriction sites with a double stop codon just before the C-terminal polyhistidine tag ...
-
bioRxiv - Immunology 2019Quote: ... B10.RIII mice (female, 6 to 8 weeks old, n = 8) were immunized with 100 μg IRBP160-181 peptide (GenScript, Piscataway, N.J.) dissolved 100 μl PBS emulsified in 100 μl of complete Freund’s adjuvant ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Neuroscience 2019Quote: ... LEC-13-8 and minimal promoters were synthesised by Genscript, USA ...
-
bioRxiv - Microbiology 2021Quote: Samples were loaded on an 8% SDS-Page gel (Genscript) with 4×106 infected RBCs or 50 μg protein for the parasite lysate approach ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 8 kb p5343 was synthesized by Genscript (Piscataway, NJ). To propagate the synthesized DNA in the model bacterium E ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Cell Biology 2023Quote: ... or SurePAGE™ Bis-Tris 8% mini gel (GenScript, Cat. #M00662), using MES-SDS running buffer (GenScript Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... bromophenol blue) without reducing agent before loading onto a 4-16% PAGE gel (GenScript ExpressPlus™). Gels were blotted on PVDF membranes and fixed in 4% formaldehyde for 30 minutes and boiled in PBS for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... This mix (16 μL) was then loaded onto 15 μL of α-FLAG G1 resin (Genscript) pre-equilibrated in FLAG resin buffer (50 mM Hepes pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Cell Biology 2020Quote: ... a PshAI/XhoI cDNA fragment encoding normal CEL with 16 VNTR repeats was synthesized by Genscript and used to replace the corresponding segment in pcDNA3/CEL-WT 14R ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Biophysics 2023Quote: ... NTS1 peptide encompassing the first 16 residues of its CTD (SANFRQVFLSTLACLC) purchased from from GenScript (>= 95% purity) was dissolved in 100% trifluoroethanol (TFE ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Biochemistry 2021Quote: 1 µg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized fom Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Immunology 2021Quote: ... 1 μg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized from Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Biophysics 2022Quote: ... Tandem repeat BtuC-BtuC-BtuD2 constructs (EE, EQ and QQ)16 were made by gene synthesis (Genscript, Piscataway, NJ), adding a (Gly4Ser)5 linker at the C terminus of BtuD ...
-
bioRxiv - Bioengineering 2023Quote: The L1 gene fragment sequences of human papillomavirus (HPV) types 16 and 18 were incorporated into the pCDNA3.1(+) plasmid by Genscript. To amplify the specific regions of interest ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified TopBP1b6-8 WT and W1145R were digested with PreScission 3C enzyme (GenScript, Z03092-500) for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... The repair templates (for Nup54-mEGFP(0) and Nup133- mEGFP(-8) were synthesized by GenScript as dsDNA ...
-
bioRxiv - Neuroscience 2023Quote: New World monkey oxytocin (Pro-8 oxytocin 75) was custom synthesized (GenScript, Piscataway, NJ, USA) and was dissolved in 0.5 mg/mL of 0.9% NaCl solution ...
-
bioRxiv - Molecular Biology 2023Quote: The synthetic peptides containing the 8-residue long LC8 binding motifs were ordered from Genscript Ltd ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Immunology 2019Quote: Peptides (Table 1) and HLA-A*11:01-restricted KRAS G12V8-16 (VVGAVGVGK) as positive peptide were synthesized from GenScript (Nanjing, China), with purity greater than 98% by mass spectroscopy ...
-
bioRxiv - Microbiology 2023Quote: ... A synthetic standard containing base positions 1-200 from the 16S rRNA gene sequence was used for the standard curve (GenScript, Rijswijk, Netherlands). The qPCR was carried out on a Strategene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on precast SurePAGE gels (Bis–Tris, 10×8, 4%– 12%, 15 wells; GenScript) and transferred to polyvinylidene difluoride membranes (Beyotime Biotechnology ...
-
bioRxiv - Biochemistry 2022Quote: Gene 8 was synthesized and cloned into pet45b using the KpnI and BamHI sites by GenScript (Piscataway, NJ). The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Immunology 2022Quote: EAE was induced by immunization of 8-12 week-old mice with 200 μg of MOG35-55 peptide (GenScript) emulsified in complete Freund’s Adjuvant (400 μg desiccated Mycobacterium tuberculosis H37 Ra mixed with incomplete Freund’s adjuvant (BD Biosciences)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... were designed using the p100pop consensus sequence (accession number KC595609.1, [8]. The sequences were commercially synthesized and cloned into a pUC57 vector (GenScript). The plasmid p100NGS_coding_FLAG_PS (accession number OQ726015 ...
-
bioRxiv - Biophysics 2021Quote: ... CCKAR–G protein complexes were assembled at room temperature (RT) for 1 h by the addition of 10 μM CCK-8 (GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Immunology 2021Quote: Active EAE was induced in 8-10 week old male and female mice by subcutaneous immunization with murine MOG35-55 peptide (Genscript) and complete Freund’s adjuvant ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a synthetic gene fragment encoding the extracellular region of a metagenomic FsxA ORF (IMG genome 3300000868, scaffold JGI12330J12834_ 1000008, ORF 8; Source Data Table 1) (GenScript) was subcloned by PCR in frame with the 5’ chicken Crypα signal peptide- and 3’ 8xHis-tag-encoding sequences of pLJ6 ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Immunology 2021Quote: EAE was induced in 8-week-old mice by subcutaneous immunization with 100 μg myelin oligodendrocyte glycoprotein (MOG35-55) peptide (GenScript Biotech) emulsified in complete Freund’s adjuvant (CFA ...
-
bioRxiv - Biochemistry 2022Quote: ... random mutagenesis library was generated by error-prone PCR (~8-10 mutations per kb) from the wildtype ecDHFR cDNA template (GenScript, Piscataway, NJ). The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit ...
-
bioRxiv - Bioengineering 2023Quote: ... the aqueous phase consisted of 10 kDa 8-arm PEG-vinyl sulfone (PEG-VS) (JenKem, Plano, TX) and RGD (Ac-RGDSPGERCG-NH2, Genscript, Piscataway, NJ) in 100 mM HEPES buffer (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid ...