Labshake search
Citations for GenScript :
1 - 50 of 957 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...