Labshake search
Citations for GenScript :
1 - 50 of 479 citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... The vectors expressing the Omicron SARS-CoV-2-spike (S1+S2)-long (B.1.1.529) and SARS-CoV-2-spike (S1+S2)-long (B.1.1.529 sublineage BA.2) were obtained from GenScript and Sino Biological ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein B.1.1.529-Omicron (RP30121, GenScript Biotecn Corp, Piscataway, NJ) were used with the simultaneous control of the wild-type ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2022Quote: ... Delta (B.1.617.2) and Omicron (B.1.1.529) were synthesized by GenScript. The production of SARS-CoV-2 S pseudotyped vesicular stomatitis virus (VSV ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... N-biotinylated synthetic peptides (ctrl, pY, or Y816A; Genscript, USA, sequences described in figure 1h) of the last 26 amino acids (aa ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The B.1.429 RBD gene was synthesized by GenScript into pCMVR with the same boundaries and construct details with a mutation at L452R ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.526 Spikes were codon-optimized and synthesized by Genscript. Plasmids encoding B.1.617 ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.351 spike cDNA was synthesized (Genscript, Piscataway, NJ, USA). Pseudoviruses were generated in BHK-21/WI-2 cells using a pseudotyped ΔG-GFP (G*ΔG-GFP ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Microbiology 2022Quote: ... mutant A and mutant B without signal peptides were synthesized by GenScript USA ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of clade B HIV-1JR-FL Env53 was codon optimized (GenScript) and cloned into expression plasmid pcDNA3.1(- ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... 220 kDa ankyrin-B F131Q/F164Q (Wang et al., 2014) was created by Genscript by site-directed mutagenesis ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV2 RBD-L452R construct California-B.1.429 (L452R) was synthesized by GenScript into CMVR with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Genetics 2021Quote: ... Flag-SARS-CoV-B.1.351-S were all obtained from GenScript (Cloned into pcDNA 3.1 vector). Flag-SARS-CoV-2-S1493-685 was made in GenScript.
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric Plexin-B constructs containing Plexin-B1 and Plexin-B2 domain swaps were produced by Genscript. Target sequences for the ECD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...