Labshake search
Citations for GenScript :
1 - 50 of 779 citations for 7 Benzothiazolol 2 1 1 dimethylethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2022Quote: Human codon-optimized sequences of the ectodomain of SARS-CoV-2 spike protein (Wuhan Hu-1 complete genome, GenBank: MN908947.1) was synthesized by GenScript, Piscataway ...
-
bioRxiv - Biophysics 2024Quote: Gene sequences for nsp7-11 and Mpro used were taken from “Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1” as published in January 2020 (replaced by NCBI LOCUS NC_045512) and commercially synthesized (GenScript). The synthetic gene sequence for nsp7-11C and nsp7-11N with suitable overhangs were cloned with Type IIS restriction enzymes into either pASK35+ and pASK33+ (IBA life sciences) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... anti-FLAG (Genscript, A00187: IB, 1:1500; IF, 1:300); anti-GAPDH (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Plant Biology 2020Quote: ... three separated segments (excluding the TCP domain) from the COM1 gene each containing 300-360 bp were synthesized (probe 1 and 2, GenScript Biotech ...
-
bioRxiv - Biophysics 2020Quote: ... Recombinant nucleocapsid protein of SARS-CoV-2 (Catalog No: Z03488- 1) and SRPK1 kinase (Catalog No: PV4215) were purchased from GenScript andThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human codon-optimized cDNA encoding SARS-CoV-2 spike glycoprotein of the WA-1/2020 and variants were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK ...
-
bioRxiv - Cell Biology 2020Quote: ... Ctdnep1-GFP and Ctdnep1 _D67E-GFP siRNA resistant sequences adding silent mutations for Ctdnep1 siRNAs #1 and #2 were synthesized (GenScript) and cloned directly to pcDNA3.1(+)-C-eGFP vector.
-
bioRxiv - Microbiology 2020Quote: The SARS-CoV-2 S gene from the Wuhan-Hu-1 isolate (GenBank: MN908947.3) was codon optimized (Genscript, Township, NJ) and cloned in pMD2iPuror in EcoRI/XhoI ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...