Labshake search
Citations for GenScript :
1 - 50 of 1075 citations for 6 tert Butyl 2 3 dihydro benzo 1 4 dioxine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biochemistry 2022Quote: ... YedK peptide consisting of the amino acids 2-16 (CGRFAQSQTREDYLA) was synthesized by Genscript. 50 nM 5’-FAM-labeled AP-DNA (FAM_U_20 ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... Samples were stimulated using pooled Spike peptides of SARS-CoV-2 (Final concentration:1μg/mL, 15-mer peptide with 11 amino acids covering the spike region, Genscript) and cultured at 37°C with 5% CO2 for 20 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... The splenocytes were stimulated for 20 hours at 37°C with RBD peptides (15-mer peptides overlapping by 9 amino acid spanning the RBD of SARS-CoV-2 spike protein, GenScript), at 5μg/mL of each peptide in RPMI + 10% FBS (R10) ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... OLP peptide pools of 15mers with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD (R319-S591, GenScript). Sequences that contained VOC mutations were exchangeable with the corresponding mutated peptides due to a modular OLP pool design.
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Immunology 2020Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire SARS-CoV-2 S protein (GenScript). After stimulation ...
-
bioRxiv - Immunology 2023Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Genomics 2021Quote: ... TERT and CTNNB1 (according to the recommended sequence by GenScript; Table S3). These codon-optimized sequences were included as additional transcripts in the reference genome for their identification from the RNA-sequencing data ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...