Labshake search
Citations for GenScript :
1 - 50 of 59 citations for 6 Oxabicyclo 3.2.1 octan 7 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Cancer Biology 2024Quote: ... membranes were exposed to ChromoSensorTM One-Solution (GenScript) for 3–5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Microbiology 2020Quote: ... or with the ONE-HOUR Western™ Standard Kit (Genscript, China).
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... One membrane was incubated with the anti-transthyretin antibody (1:1,000; Genscript) in 5 % milk overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Molecular Biology 2020Quote: ... was directly amplified from a plasmid containing a codon-optimized version of klp-7 (klp-7_co synthetic gene) synthesized from GenScript (Table S5).
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Immunology 2022Quote: The coding sequences for the extraviral domain of VARV A33 with N terminus 6×His tag and C-terminus Avi-tag were synthesized by GenScript and directly cloned into the PET-28a(+) ...
-
bioRxiv - Plant Biology 2020Quote: ... coli codon-optimized gene for Arabidopsis UVR8 was introduced into the pET11a expression vector generating a construct carrying an N-terminal 6×His-tag (Genscript). The construct was verified by DNA-sequencing and transformed into the E ...
-
bioRxiv - Biophysics 2021Quote: ... Both ghrelin receptor–Gq complexes were formed on the membrane in the presence of 10 μM ligands (ghrelin or GHRP-6, synthesized by GenScript) and treated with apyrase (25 mU/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Biochemistry 2023Quote: ... T4-foldon trimerisation domain and ADAH11 spaced by glycine-serine linker sequences (Supplementary Table 6) was inserted into the pHEN6 plasmid (Genscript), expressed in T7 Express E ...