Labshake search
Citations for GenScript :
1 - 50 of 545 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2022Quote: ... basic and Methyl-mimic mutants were synthesized by Genscript with N-terminal NheI and C-terminal Acc65I restriction enzyme site s flanking the DUX4 ORF ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... membranes were exposed to ChromoSensorTM One-Solution (GenScript) for 3–5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...