Labshake search
Citations for GenScript :
1 - 50 of 143 citations for 5 β DIHYDRO 17 HYDROXYPROGESTERONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... murine IL-12α and β genes (Uniport no. P43432) [17] were also synthesized (GenScript) and cloned into pSFTSV (pSFTSV-IL-12 ...
-
bioRxiv - Biochemistry 2022Quote: Heavy and light chain sequences of CS-17 were determined from sequencing of CS-17 murine hybridoma cell line PTA-8174 (ATCC) by Genscript. The resulting sequences were cloned into a pCDNA3.4-containing murine IgG2a construct ...
-
bioRxiv - Biophysics 2023Quote: ... and FAM-labeled StpA2-17 were purchased from GenScript Japan (Tokyo ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Cell Biology 2024Quote: ... a minigene block that contains exons 10 -17 of cgATF6⍺ (785bp; GenScript) was digested with AgeI and AflII and ligated into AgeI/ AflII-digested pUC57 plasmid ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal β-catenin(A01211-40; Genscript, China), rabbit polyclonal YAP1(A1002 ...
-
bioRxiv - Immunology 2022Quote: ... or TN peptide (β-hex peptide sequence YKGSRVWLN - GenScript)27 was added to the wells ...
-
bioRxiv - Cell Biology 2024Quote: cDNA encoding native integrin α and β-subunits from Genscript (gene and accession No ...
-
bioRxiv - Biochemistry 2022Quote: ... laevis GST-importin-α and GST-importin-β generated by GenScript and purified from serum according to previously published protocols (Alfaro-Aco et al. ...
-
bioRxiv - Immunology 2023Quote: CPG2 and β-Lac proteins were produced and purified by GenScript as previously described (7) ...
-
bioRxiv - Biochemistry 2019Quote: ... oligomer and aggregate were prepared by our previously reported methods.17 Acetylated-K16 Aβ1-40 was purchased from GenScript. Purified anti-β-Amyloid 1-16 (clone 6E10) ...
-
bioRxiv - Biophysics 2023Quote: Peptides were synthesized with C-terminal amidation (to reduce unwanted charge effects at the carboxy terminus) to generate wild-type and variants of the 17 N-terminal residues of CXCL12 (KPVSLSYRCPCRFFESH) (GenScript Biotech), a peptide known to elicit calcium mobilization and Gαi coupling signaling20 ...
-
bioRxiv - Biochemistry 2022Quote: The β-barrel (amino acid 21 to 323) subdomain was produced by Genscript Biotech ...
-
bioRxiv - Immunology 2022Quote: ... 55 μM β-mercaptoethanol) supplemented with 20 μg/mL MOG35-55 peptide (GenScript), 20 ng/mL IL-12 (Biolegend) ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: Antibodies obtained from commercial sources were as following: β-actin and Histone H3 from Genscript, Ku86 (C-20 ...
-
bioRxiv - Microbiology 2019Quote: The synthetic XIP (ComS11-17; GLDWWSL) (8, 26) and the 18-CSP (ComC26-43; SGSLSTFFRLFNRSFTQA) (16) were synthesized by GenScript (GenScript Corporation, NJ, USA), both with an estimated purity of 98% (26) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Immunology 2023Quote: ... Peptides TAT-HKII (MIASHMIACLFTELN(β-Ala)GYGRKKRRQRRG-amide) and TAT (GYGRKKRRQRRG-amide) were custom-made by GenScript.
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Cell Biology 2023Quote: ... The HA-tagged wild-type PITPα/β constructs and PI-binding deficient mutants T59D33 were purchased from Genscript. Constructs were transfected in mammalian cells by the lipid-based delivery system from Invitrogen (LipofectamineTM3000 ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Physiology 2021Quote: ... whereas the β-subunit of VHA was immunodetected using a custom-made polyclonal rabbit antibody (epitope: AREEVPGRRGFPGYC; GenScript, Piscataway, USA). These antibodies have been previously used in the inner ear of the Pacific chub mackerel (Scomber japonicus ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Immunology 2022Quote: ... The TCR variable region in combination with mouse TCR α and β constant regions was then obtained as synthetic DNA (GenScript) that was subcloned into the pMIG II vector and used for transduction36.
-
bioRxiv - Microbiology 2020Quote: ... class C-like β-lactamase protein (gi|919167542) and the Elizabethkingia GOB-13 (AY647250) were synthesized by GenScript (Piscataway, NJ, USA) and optimized for protein expression in Escherichia coli in the pET24a(+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Neuroscience 2022Quote: ... we custom synthesized a codon-bias optimized Drosophila melanogaster β-tubulin85D gene in which S172 and T219 were mutated to either glutamate (E) or alanine (A) (GenScript, Piscataway, NJ). Each synthesized gene was FLAG-tagged at the C-terminus and subcloned into pUAST-attB ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Bioengineering 2023Quote: Genes encoding the Nb24 and mNb6 WT nanobodies and their humanised variants were synthesized and cloned into an isopropyl-β-D-thiogalactopyranoside (IPTG)–inducible vector (by Genscript in vector pET29a(+)) ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5×sample buffer (MB01015, GenScript), heated to 100°C for 8-10 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...