Labshake search
Citations for GenScript :
1 - 50 of 965 citations for 2' 3' cGAMP STING based FRET Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Microbiology 2023Quote: ... species-independent surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit, GenScript, the Netherlands). The test was performed as prescribed by the manufacturer using a cut-off of ≥ 30 % for positivity and < 30 % for negativity ...
-
bioRxiv - Immunology 2021Quote: Levels of neutralizing antibodies in serum samples were determined by cPASSTM SARS-CoV-2 neutralization antibody detection kit (GenScript, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Secondary assessment of the RBD-ACE2 interaction blocking potential of the isolated nanobodies was performed using the Genscript SARS-CoV-2 Neutralization Antibody Detection Kit (#L00847, Genscript) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... FRET-labeled 207 bp DNA was prepared by PCR using labeled primers (GenScript) ATCGGACCC/iCy5N/ATACGCGGCC (forward primer) ...
-
bioRxiv - Microbiology 2021Quote: ... The FRET-pair substrate Abz-LPETG-Dap(Dnp)-OH (Genscript, Piscataway, NJ, Unites States) and the tetraglycine (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tartan (Rabbit, 1:100, This study, GenScript, based on Full-length peptide). Donkey and Goat secondary antibodies conjugated to AlexaFluor488 ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... and Omicron (B.1.1.529) Spike genes were based on the codon-optimised spike sequence of SARS-CoV-2 and generated by GenScript Biotech ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... monomers and LPS were detected using endotoxin detection kit following the manufacturer’s protocol (GenScript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Molecular Biology 2024Quote: ... or LV1-eGFP-miR-7 were generated by subcloning inserts from pAAV_hSYN1-eGFP-miR-7 and pAAV_hSYN1-eGFP (provided by Thomas B. Hansen) inside LV1 (immunodeficiency virus 1 (HIV-1)-based LV-PGK-GFP) backbone by GenScript Biotech Corporation ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Neuroscience 2024Quote: ... N-terminal-myristoylated peptides based were on based on the C-terminal sequence of the mouse NR1C2 and custom ordered from GenScript. The wildtype sequence was NQKDTVLPRRAIERE ...
-
bioRxiv - Biochemistry 2021Quote: ... peptide-based Inhibitor candidates were synthesized by GenScript and LifeTein ...
-
bioRxiv - Immunology 2021Quote: Pseudo-neutralization assays were performed on hamster serum using the cPassTM Neutralization Antibody Detection kit (GenScript).
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Inhibitory ExbD-based cyclic peptides were purchased from GenScript USA ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... was synthesized based on MARV strain Musoke (GenBank: DQ217792) by GenScript Biotech ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... It was chemically synthesized and inserted into a pUC57 based vector (GenScript). The encoding DNA fragment of the INSL5 precursor was confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Microbiology 2019Quote: ... and VP24 coding sequences (based on accession number KX371887) were synthesized by Genscript. The synthesized open reading frames were cloned into a pCAGGS expression vector with a FLAG-tag at the N-terminus of each coding sequence ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...