Labshake search
Citations for GenScript :
201 - 250 of 892 citations for Rat Translational Activator Of Cytochrome C Oxidase 1 TACO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... The expression of PDGFRβ and CSF1R was detected by western-blotting using anti-protein C antibody (Genscript, USA). The phosphorylation levels of PDGFRβ or CSF1R were detected by western-blotting using 4G10 antibody (Merck Millipore ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by denaturation at 95°C for 10 min and loading on 4-20% ExpressPlusTM PAGE gels (GenScript). The gel was allowed to run at 120V for 2 hours ...
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...
-
bioRxiv - Neuroscience 2021Quote: ... scrambled C1.2 (AATRSTFASKTLIS) were synthesized with a Tat sequence (YGRKKRRQRRR) at the C-terminal by GenScript (Piscataway, NJ, USA). Scrambled sequences were confirmed to not match other protein sequences in mice by Blast search.
-
bioRxiv - Molecular Biology 2019Quote: ... Clone OHu31338D containing the open reading frame of the human ALKBH3 in pcDNA3.1 with C-terminal FLAG tag was obtained from GenScript, U.S.A ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 variant spike constructs with N- and C-terminal flag tags were produced and cloned into a pcDNA3.1 vector by GenScript Biotech (Piscataway ...
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Cell Biology 2022Quote: ... the coding sequence of PlyA2 (accession number AB777517) fused to mCherry at the C-terminus was synthesized by GenScript® ...
-
bioRxiv - Biophysics 2022Quote: The C-terminal FLAG-tagged mouse mGluR2 construct in pcDNA3.1(+) expression vector was purchased from GenScript (ORF clone: OMu19627D) and verified by sequencing (ACGT Inc) ...
-
bioRxiv - Biochemistry 2021Quote: ... and C: 861TLFRQM[pS]SGAI) with numbering indicating position in mouse HCN1 were commercially synthesized (GenScript Peptide Synthesis Service). Experiments were conducted at 25 °C in PBS (pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3.1+C-HA Trp53 (OMu22847) and pcDNA3.1+C-FLAG Ppia (OMu14516) plasmids used in mammalian over-expression experiments were purchased from Genscript. The detailed information regarding plasmid constructions is available by request ...
-
bioRxiv - Cell Biology 2022Quote: ... The C-terminal BAP tag of localized mitosomal proteins was detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal marker GL50803_9296 was detected by a rabbit anti- GL50803_9296 polyclonal antibody (3) ...
-
bioRxiv - Microbiology 2024Quote: A DNA fragment encoding ELC07 Fab heavy chain with a C-terminal hexahistidine (His6) tag and subcloned into pcDNA3.1 was generated by GenScript. The constructs used for expression of stabilised trimeric HIV-1 Env (BG505 SOSIP.664 ...
-
bioRxiv - Biochemistry 2023Quote: The Fis1 N-terminal arm peptide (MEAVLNEL) with N-terminal acetylation and C-terminal amidation were purchased from GenScript who determined the peptide to be >95% pure by HPLC ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Immunology 2022Quote: ... fused at the C-terminus to the Fc region of human IgG1 and cloned into pcDNA3.1(+) vector by Genscript.
-
bioRxiv - Microbiology 2023Quote: ... The following plasmids were used in this study: FLAG tagged ORFs in pcDNA3.1+/C-(K)DYK were purchased from Genscript: CDK1 (NM_001786.5) ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Microbiology 2020Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Cancer Biology 2021Quote: The human FOXA1 sequence with RefSeq accession ID NM_004496 was synthesized with a C-terminal V5-tag sequence and obtained in pCIneo vector with NheI and XhoI cloning sites from GenScript. The sequence with the C-terminal V5-tag was transferred to the pEF1neo mammalian expression vector using NheI and SalI ...
-
bioRxiv - Immunology 2021Quote: ... 1×105 PBMCs were plated per well in triplicate with a single overlapping peptide pool spanning spike from the N to C terminus (GenScript, 15 amino acid length ...
-
bioRxiv - Genetics 2021Quote: ... This construct with a C-terminal 3x HA epitope tag was generated and subcloned into pUASTattB by Genscript (NJ, USA). Transgenic flies were generated by Genetivision (Houston ...
-
bioRxiv - Molecular Biology 2020Quote: Commercial synthetic Ste18Nt peptides were synthesized with N-terminal acetylation and C-terminal amidation and various combinations of S3 and S7 phosphorylation (or non-phosphorylated) and enriched to 95% purity (Genscript). Lyophilized peptides were reconstituted in deionized water at a concentration of 2.5 mg/ml and further diluted as necessary with 10mM potassium phosphate buffer (pH 7) ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then heated for 5 minutes at 85°C and separated by SDS-PAGE and analyzed by Western blot using rabbit anti-GST antibody (Genscript), rabbit α-RSV CA ...
-
bioRxiv - Microbiology 2019Quote: Mammalian expression plasmids (pcDNA3.1+/C-(K)DYK) for HLA-DRA (NM_019111) and HLA-DRB1 (NM_001243965) were purchased from GenScript (Piscataway, NJ; USA). HEK293T/17 cells at sub-confluence in 6-well plates or 100 mm dishes were transfected with HLA-DRA plasmid or HLA-DRB1 plasmid or a 1:1 combination of both using the Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Immunology 2021Quote: Membrane proteins from OP-treated or untreated JEG-3 or purified FC-tagged full length or truncated domains of CRT were incubated with 20 μg of NCR-Myc fusion proteins at 4° C with rotary agitation for 16 h and then with 100 μl anti-Myc coupled magnetic beads (Genscript) at 4° C with rotary agitation for 4 h ...
-
bioRxiv - Bioengineering 2020Quote: DexVS gels were formed via a thiol-ene click reaction at 3.3% w/v (pH 7.4, 37°C, 45 min) with VPMS crosslinker (12.5, 20, 27.5 mM) (GCRDVPMSMRGGDRCG, Genscript, George Town, KY) in the presence of varying amounts of argininylglycylaspartic acid (RGD ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 St containing 2X-StrepTag at the C-terminal region was commercially synthesized as mentioned above (GenScript Biotech). SARS-CoV-2 N ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were dried down under a stream of nitrogen at 42°C and treated with recombinant ceramide glycanase (rEGCase; GenScript) to release ceramide-linked glucosylceramide derived GSL oligosaccharides ...
-
bioRxiv - Systems Biology 2021Quote: ... The +1 nucleotide was mutated to all other nucleotides (G, C or T) and these 3 mutant plasmids were synthesized into DNA oligos and cloned by Genscript.
-
bioRxiv - Cell Biology 2021Quote: ... The base Scarlet I-pDM304 expression plasmid for C-terminal fusions was generated by restriction enzyme cloning a codon-optimized synthesized Scarlet I gene (GenScript) into the extrachromosomal expression plasmid pDM304 (Veltman et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... linker with both N-terminal and C-terminal 10×His-tags with a cysteine adjacent to each 10×His tag in a pET21b vector (Genscript). The plasmid was transformed into T7 express cells (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... we obtained an expression plasmid containing a C-terminal 3Xflag tagged BioID2 sequence with a 198bp (13X “GGGGS” repeat) linker sequence upstream of BioID2 (Genscript). For lentiviral expression ...
-
bioRxiv - Neuroscience 2022Quote: Gja1 overexpression in ANS4-GFP was performed using a pcDNA3.1+ /C-(K)DYK vector containing mus musculus Gja1 (Cx43) cDNA (GenScript NM_010288.3). Transfection was performed according to the manufacturer’s experimental protocol in 6-well plate ...
-
bioRxiv - Biochemistry 2022Quote: ... four copies of inhibitory peptide or control peptide with mutated binding motif spaced out by a flexible GST linker and fused to C-terminus of EGFP were ordered from GenScript. At 72 h post transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... gene was codon-optimized and cloned into the p423_GAL1 yeast expression vector as an N-terminal Flag (DYKDDDDK) and C-terminal decahistidine (10X His) tagged fusion protein (GenScript) (Fig ...
-
bioRxiv - Microbiology 2020Quote: The I53-50B.4PT1 was codon-optimized and synthesized and then cloned into a modified pET28a* vector with a C-terminal hexahistidine tag by Genscript.
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...