Labshake search
Citations for GenScript :
2201 - 2250 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Cell Biology 2023Quote: ... a twelve-nucleotide linker region and ending with a BglII restriction site was synthesized by GenScript into the pUC57 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... MAPPGMRLRSGRSTGAPLTRGSC (GenScript) was dissolved in water.
-
bioRxiv - Cell Biology 2023Quote: ... The gel was transfered onto PVDF membrane (GenScript, L00726) using Genscript eBlot (GenScript ...
-
bioRxiv - Cell Biology 2023Quote: ... The chimeric constructs were synthesized by GenScript (Piscataway, NJ, USA), and sub-cloned into the pCI-neo-λN-v5 vector using XhoI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane sections were then incubated overnight at 4°C with the corresponding antibody: anti-ChmA (dilution = 1:500; custom GenScript polyclonal rabbit antibody), HRP-conjugated mouse anti-RpoB (dilution = 1:5,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Genscript eBlot (GenScript, L00686) for 16 min ...
-
bioRxiv - Developmental Biology 2023Quote: Generation of sponge lines: Sponge constructs were synthetized by GenScript Biotech Corporation (NL) ...
-
bioRxiv - Developmental Biology 2023Quote: Anti-Miranda polyclonal antibody was generated by Genscript (https://www.genscript.com/). The epitope used for immunization is ...
-
bioRxiv - Cell Biology 2023Quote: ... or through gene synthesis (Genscript). For insect cell expressions ...
-
bioRxiv - Biophysics 2023Quote: The cDNA fragment encoding full-length Strongylocentrotus purpuratus SLC9C1 was synthesized (Genscript Inc.) and cloned into a modified pEG BacMam vector39 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The pooled sgRNA library was purchased from GenScript in a plasmid format utilizing the pLentiGuide-Puro vector ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Biochemistry 2023Quote: ... we applied the synthetic gene approach to synthesize (GenBank X04370.1) a codon-optimized pGEX 6P1 expression vector from GenScript. IE62 1-86 and 87-200 were amplified by PCR (template IE62 1-200) ...
-
bioRxiv - Bioengineering 2023Quote: ... and RGD (Ac-RGDSPGERCG-NH2, GenScript) in 0.3 m triethylamine (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... The synthetic DNA was cloned into pET29a (+) using the NdeI and BamHI restriction sites (GenScript) and transformed into BL21(DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... The Galectin1 and Endo F3 gene were synthesized and cloned to pET28a plasmid by GenScript Corporation ...
-
bioRxiv - Biochemistry 2023Quote: T.gondii-GalNAc-T3 (aa 74–635) was cloned from a T.gondii-GalNAc-T3 cDNA template (GenScript AY160970.1 ...
-
bioRxiv - Biochemistry 2023Quote: The DBC1-NHD fragment (residues 354-396) derived from the human DBC1 (Uniprot code: Q8N163) was synthesized and subsequently cloned into the pETM41 vector by GenScript Biotechnology Co. ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse spleen cells were stimulated with 2 μg/ml S1、S2 peptide pools spanning SARS-CoV-2 spike S1 and S2 respectively (15mers, overlapping by 11aa, GenScript) or equimolar amount of DMSO (negative control ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Bioengineering 2023Quote: ... and a dithiol MMP-degradable peptide (GCKGGPQG↓IWGQGKCG, Genscript) replaced the DTT while maintaining the same thiol:norbornene ratios.
-
bioRxiv - Biochemistry 2023Quote: The DNA coding for the LRRK2 residues 1327 to 2527 (OHu107800 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGAAAAAGGCTGTGCCTTATAACCGA and the reverse primer TATCCACCTTTACTGCTCTCAACAGATGTTCGTCTCATTTTTTCA ...
-
bioRxiv - Bioengineering 2023Quote: ... μgels formulated using HA-NB (3.4 wt% (w/v)) precursor solution in 0.3 M HEPES buffer with 3.5 mM MMP-cleavable crosslinker (Ac-GCRDGPQGIWGQDRCG-NH2, GenScript), 1.75 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Biochemistry 2023Quote: DUS1L and DUS2L cDNA were obtained from Genscript (NM_022156.5 and NM_017803.5). For construction of Flp-In cell lines ...
-
bioRxiv - Biochemistry 2023Quote: The pETG20A_SPB vectors with BARHL2 and its mutant sequences (GenScript) were expressed in Rosetta(DE3)pLysS E.coli strain (Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: LHa peptide (Table 1) was obtained from GenScript with a γ-aminobutanoate-mercaptopropionic acid linker (hereinafter referred to as LH2 peptide ...
-
bioRxiv - Biophysics 2023Quote: ... NdeI/XhoI-digested plasmid pET29a vector (GenScript) with 6xHis tag included at the N-terminus ...
-
bioRxiv - Bioengineering 2023Quote: ... The synthetic peptides AM1 (theoretical Mw = 2472 g·mol-1) and SurSi (theoretical Mw = 3632 g·mol-1) were designed in our lab and synthesized by GenScript® (Nanjing ...
-
bioRxiv - Biophysics 2023Quote: ... coli and synthesized (GenScript), based on the published 3CLpro expression and crystal structure (Jin et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmid of tetraubiquitin (Ub4) was ordered from GenScript. This plasmid contains the ubiquitin gene repeated four times and contains a N-term GST tag as well as a 3C HRV cleavage site.
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Bioengineering 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and then incubated with the Anti-DYKDDDDK M2 resin (Genscript) for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... All peptides were purchased from GenScript (Piscataway, NJ, USA) with C-terminal amidation and more than 98% purity ...
-
bioRxiv - Biochemistry 2023Quote: ... The construct was purchased from GenScript then packaged in-house using HEK293T cells with psPAX2 ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: All pcDNA3.1 plasmids constructed here were produced by GenScript.
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Biochemistry 2023Quote: ... all cDNAs were commercially obtained (GenScript). The human ORFs were engineered to also have 39 bp of flanking sequence on both the 5′ and 3′ends that equivalently matched the flanking sequences of the orthologous yeast ORFs ...
-
bioRxiv - Biochemistry 2023Quote: ... and 500 μg/mL synthesized FLAG peptide (GenScript Co., Ltd.). The eluted protein was further purified by SEC using a Superose 6 increase 10/300 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA of human STK25 isoform 1 (RefSeq accession no. NM_001271977.2) was cloned into the pcDNA3.1+ vector (GenScript). The Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... and A1659V variants were custom made (Genscript, Piscataway, NJ, USA).
-
bioRxiv - Biochemistry 2023Quote: ... Eight hLF mutants were produced by introducing desired point mutations during synthesis of DNA fragments (GenScript). The plasmids encoding the wild type (WT ...
-
bioRxiv - Biochemistry 2023Quote: hMfr mutants were generated by GenScript. The expression ...
-
bioRxiv - Immunology 2023Quote: ... heavy and light chain genes were synthesized by GenScript, inserted separately into plasmids (pCMV3-CH ...
-
bioRxiv - Biophysics 2023Quote: ... Sup35NM was visualized using an antibody raised against residue 125-253 of the protein(GenScript). Cell lysates were fractionated by SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: Spike815–823 peptide (residues 808-833) and stem helix (1140-1163) peptides and mutated variants were commercially synthesized (Genscript). The following Spike proteins were used ...