Labshake search
Citations for GenScript :
2151 - 2200 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Mid1 and YAP1 Crispr/Cas9 knockout transfer plasmid were purchased from GenScript; For Erdr1 overexpression ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Immunology 2023Quote: ... and CD3ζ were synthesized by Genscript and subcloned into SFG gamma-retroviral vector ...
-
bioRxiv - Immunology 2023Quote: ... and ADA1.CD3scFv were synthesized by Genscript and subcloned into SFG gamma-retroviral vectors ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Molecular Biology 2023Quote: ... basic coil motif (AQCKKKLQALKKKNAQLKWKLQALKKKLAQ) and 6xHIS tag inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The region encoding the α4 ectodomain (M1-Q970 ...
-
bioRxiv - Molecular Biology 2023Quote: ... acidic coil motif (AQCEKELQALEKENAQLEWELQALEKELAQ) and Strep-Tag II (WSHPQFEK*) inserted into a pcDNA3.1-Hygro(-)-like backbone was synthesized commercially (GenScript). The R177G/R178G ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Molecular Biology 2023Quote: The full-length Xenopus HURP sequence (NCBI Reference Sequence: XP_018087757.1) was synthesized (Genscript) with codon optimization for expression in Escherichia coli in a pUC57 vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... was directly synthesized (General Biosystems, China) and cloned between the PciI and NdeI restriction sites of the backbone vector pUC57-Kan (GenScript).
-
Modifications in the T arm of tRNA globally determine tRNA maturation, function and cellular fitnessbioRxiv - Molecular Biology 2023Quote: ... which were detected after incubation with 120 ng/mL streptavidin-HRP (Genscript) in hybridization buffer for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gene synthesis was done by GenScript, and the resulting plasmid sequences were verified using Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 45nM purified LwaCas13a (Genscript, stored in 100 mM Tris HCl pH 7.5 and 1 mM DTT) ...
-
bioRxiv - Microbiology 2023Quote: ... A full length TgLaforin cDNA containing its endogenous 5’UTR (2000 bp upstream from gDNA) was synthesized by GenScript and inserted into a pHA3x-LIC vector (Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Custom primers and probes were ordered from Genscript to quantify the different splice variants (see Table S1 for sequences and Figure 2 for alignment on the minigene sequence) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli codon-optimized CboTnpB and bioinformatically predicted ωRNA were synthesized and cloned into a single pCDF-Duet vector by Genscript, with two separate J-23 series promoters driving their expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA templates were synthesized by GenScript or constructed via the Gibson assembly method (primers for cloning are listed in Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FYNB (NM002037.5) flanked by two gateway sites have been synthesized and cloned in PUC57 plasmid (GenScript, Hong Kong). These two clones were individually transferred by Gateway recombinational cloning into pDONR207 vector ...
-
bioRxiv - Microbiology 2023Quote: ... CEACAM3 were purchased from GenScript (#OHu25975C ...
-
bioRxiv - Microbiology 2023Quote: ... the coding sequences (CDS) of target SP and CT peptides were commercially synthesised (IDT, GenScript) as fragments codon-optimised for expression in E ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Microbiology 2023Quote: Sequential site-directed mutagenesis was performed using wild-type ALKBH1 plasmid (OHu05179, GenScript) as a template with the following primer pairs ...
-
bioRxiv - Molecular Biology 2023Quote: ... approximately 25 μM positive-sense strand ssRNA synthesized by IVT was annealed with 25 μM each of the two RNA oligonucleotides (synthesized chemically by GenScript) corresponding to the two segments of the negative-sense strand ssRNA.
-
bioRxiv - Evolutionary Biology 2023Quote: All constructs were codon-optimized and synthesized by Genscript (Piscataway, NJ) into the pEAK10 expression vector.
-
bioRxiv - Cancer Biology 2023Quote: The oligonucleotides for the crRNA library were synthesized by Genscript. The sequences were collectively amplified with primers that generated 40 bp homologies with the pLentiRNAGuide_001 vector digested with BsmBI and XhoI ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Cell Biology 2023Quote: ... corresponding cDNAs were subcloned under control of Actin5C promoter (GenScript). The resulting constructs had N-terminal Halo or EGFP tags (Nv-Osk ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Biochemistry 2023Quote: ... The modified TARPγ2 peptides were obtained from GenScript Biotech (Piscataway ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies against AFF3IR-ORF1 in mouse and against AFF3IR-ORF2 in rabbit were synthesized by GenScript (Piscataway, NJ, USA). The antibodies against Sca-1 (ab51317) ...
-
bioRxiv - Cell Biology 2023Quote: The cDNA sequence for the 151-aa of ORF2 were synthesized (Genscript) with FLAG tag sequence inserted downstream the ATG start codon and cloned to pShuttle 2 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Both plasmid cloning and BacMam virus generation were done by GenScript (Nanjing, China).
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Cell Biology 2023Quote: The human Calpain 3 and 21 bp-deletion Calpain 3 mutant were synthesized and sub-cloned in the pcDNA3.1 vector containing a C-terminal FLAG tag by GenScript. Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Cell Biology 2023Quote: ... An empty donor vector (attL1+2_pGenDONR) was also purchased from GenScript. AKAP2 WT and DSG2 pGenDONR plasmids were subcloned into pInducer20 using gateway recombination ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKAP2 DSG2 (pGenDONR) were purchased from GenScript. An empty donor vector (attL1+2_pGenDONR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and αB-crystallin cDNAs were purchased from Genscript, and the recombinant proteins were purified as previously described15 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA covering the full-length Xenopus laevis SART1 (NM_001086027.1) was in vitro synthesized (GenScript) and subcloned into pET28a (Novagen ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-3C-FIP200-EGFP in a pGB-02-03 vector from Genscript (Addgene_187832). The V1 virus was generated as described above for SINTBAD ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-TEV-TBK1 and GST-TEV-EGFP-TBK1 in a pFastBac-Dual vector from Genscript (RRID:Addgene_208875 and Addgene_187830 ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-TEV-SINTBAD-EGFP and GST-TEV-SINTBAD-mCherry in a pFastBac-Dual vector from Genscript (RRID:Addgene_198035 and RRID:Addgene_208874) ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... FAM177A1-Halo and FAM177A1-SNAP are all cloned fromFAM177A1 pcDNA3.1+/C-(K)-DYK (GenScript Clone ID:OHu30351D) using the primers in (Table S1 ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... ZFPL1-GFP was purchased from GenScript (Clone ID ...
-
bioRxiv - Cell Biology 2023Quote: The antibody against B55α was generated by immunizing rabbits with a synthetic peptide corresponding to the first 15 amino acids of the N-terminal region of B55α (MAGAGGGNDIQWCFS) conjugated to keyhole limpet hemocyanin (Genscript). The resulting sera were purified with CNBr-activated sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Developmental Biology 2023Quote: ... fused in frame to the flexible linker and eGFP sequence was synthetized by GenScript and cloned using XbaI/XhoI sites in pCAGGS vector for electroporation (ITGA4:EGFP_pCAGGS).
-
bioRxiv - Genetics 2023Quote: ... The probes were ordered from GenScript, and amplified as previously described 23 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were commercially synthesized by Genscript (Genscript USA, Piscataway, NJ) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...