Labshake search
Citations for GenScript :
2051 - 2100 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: HA encoding cDNAs of A/turkey/Italy/214845/02 H7N3 (63) (synthesized and codon-optimized by GenScript), A/duck/Australia/341/1983 H15N8 (a kind gift from Keita Matsuno) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and K193R (H3 numbering) was ordered from GenScript and inserted into the HA of A/chicken/Germany/R28/2003 in a pHWSccdB vector by restriction enzyme cloning ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the 1.0x co-cultures were assessed with supplementation of 20 µM ɑ-factor (GenScript). Yeast was pre-cultivated in 0.5 mL SC (24 hrs. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Algal-adapted coding sequences were synthesised and sub-cloned into pOptimized_3 expression plasmids35 by Genscript (Piscataway, NJ, USA). Ketocarotenoid biosynthesis in alga was achieved by transformation with the pOpt2_CrBKT_aadA plasmid51 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Anti-streptag purified antibody (Genscript) was also APC conjugated ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cerevisiae using GenSmart Codon Optimization (GenScript) and excluded the BsaI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 10 µM P-factor (peptide-seq.: TYADFLRAYQSWNTFVNPDRPNL) (GenScript), DIX61 (MTNR1A ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0- 1 µM) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Neuroscience 2023Quote: Synthetic peptides (>95% pure) were obtained from GenScript. YGRKKRRQRRR was used as the Tat sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... and generated by site directed mutagenesis by Genscript (New Jersey, USA). Plasmids were heat transformed into subcloning efficiency chemically competent DH5α cells (Thermofisher ...
-
bioRxiv - Molecular Biology 2023Quote: The wild-type ASPA cDNA and selected variants studied in low throughput were generated by Genscript. The library cloning and barcoding described below are essentially as previously described 69 ...
-
bioRxiv - Molecular Biology 2023Quote: All peptides were either custom synthesized from Genscript (NJ, USA) or synthesized in-house using a standard automated solid-phase peptide synthesizer (Liberty Blue microwave peptide synthesizer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pBY011 plasmid encoding yeast CHD1 gene under the GAL1/10 promoter was obtained from a DNASU plasmid repository and altered by GenScript, where FLAG tag and NES-NES sequences were added to the N- and C-termini of the gene ...
-
bioRxiv - Neuroscience 2023Quote: ... Combined mutants were synthesized by Genscript. Isolation of high-copy plasmid DNA from E ...
-
bioRxiv - Neuroscience 2023Quote: ... In some experiments 100 nM CabTRP Ia (GenScript) was added to the saline ...
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... and EGFP were synthesized by GenScript, and subcloned into pGenLenti backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus was gen-erated by GenScript or BrainVTA with titer QC’d at >1×10e8TU10e8TU/mL ...
-
bioRxiv - Neuroscience 2023Quote: Peptides (GenScript) were modified with a cysteine on the N-terminus ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysate from equal number of DRGs was loaded and separated by electrophoresis on 4-12% ExpressPlus gels (Genscript M41210), followed by transfer to a PVDF membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... 2011) or fluorescein Piccolo-peptides (fluor-IEDEEKPVDLTAGRRA) were synthesized and purified (>90% purity) by GenScript. Peptides were solubilized and frozen as a stock solution of 20 mM in water and diluted to a final concentration of 10 µM.
-
bioRxiv - Neuroscience 2023Quote: ... The construct consisting of human APP770 cDNA in the pcDNA3.1 backbone was custom made (GenScript, Piscataway) and then sequenced ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting fusion protein with its corresponding SP-gRNA was cloned into the PX458 vector by GenScript. HA tag was included for detection of the fusion protein ...
-
bioRxiv - Neuroscience 2023Quote: ... while the Copiagag antibodies were generated against a Copia peptide antigen (see Figure 1) by immunizing rabbits with the peptide LMVVKNSENQLADIC (GenScript).
-
bioRxiv - Neuroscience 2023Quote: ... A single-stranded DNA repair construct (synthesized by Genscript) with the sequence 5’- CTGGGCTGACAAACATCAAGACGGAAGAGATCTCGGAAGTGAAGATGGATGCAGA ATTCCGACATGATTCAGGATATGAAGTCCATCATCAAAAACTGGTAGGCAAAAATAAACTGCCTCTCCCCGAGATTGCGTCTGGCCAGATGAAAT-3’ was used to introduce the G601R ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into pcDNA3.1 (+) by GenScript. HEK293T cells were seeded in a 10 cm dish and transfected with 12 μg pcDNA3.1 Spike plasmid using Lipofectamine 2000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-V2R was synthetized by GenScript and HA-V2β2AR was generously provided by Dr Robert Lefkowitz (Duke University ...
-
bioRxiv - Biophysics 2023Quote: The peptides CPSF6313–327 (CPSF6p) and CPSF6313–327 with an extra cysteine at the C-terminus (CPSF6p-Cys) were synthetized by GenScript. Peptides were dissolved in water at a concentration of 2.5 mM and stored in aliquots at -40°C.
-
bioRxiv - Microbiology 2023Quote: ... The following plasmids were used in this study: FLAG tagged ORFs in pcDNA3.1+/C-(K)DYK were purchased from Genscript: CDK1 (NM_001786.5) ...
-
bioRxiv - Cell Biology 2023Quote: ... LgBiT-mGsq and SmBiT-βarr1 were synthetized by GenScript. mGsq and βarr1 were tagged in amino-terminal with LgBiT and a linker peptide and SmBiT ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Neuroscience 2023Quote: ... in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder) for the other cases ...
-
bioRxiv - Neuroscience 2023Quote: ... Gly1-SIFamide (GYRKPPFNG-SIFamide, custom peptide synthesis: Genscript) (17 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLKO lentiviral vectors were obtained from Sigma (SHC001) and cloning was performed by GenScript.
-
bioRxiv - Genomics 2023Quote: Destination vectors were synthesized and sequence-verified by Genscript. Destination vectors were pre-digested using BbsI (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: Antibody heavy and light chain genes were synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant mouse interleukin-11 (rmIL11) (Z03052, Genscript, Oxford, UK) was dissolved in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: Recombinant bacmids and recombinant baculovirus stocks were produced by GenScript. The high-titer P2 was used to make P3 baculovirus for a large-scale expression ...
-
bioRxiv - Neuroscience 2023Quote: ... GST-α-syn 96-140 Scr and GST-α-syn 96-110 Scr plasmids were synthesized by GenScript (Piscataway, NJ, USA). All constructs were verified by sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... Peptides were synthesized by GenScript (Piscataway, NJ). Trypsin and peptide desalting columns were obtained as Pierce products from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2023Quote: ... Phosphomimetic tau variants were produced by GenScript.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Nb protein sequences acquired from literature (previously named 22A3 and 23A3)35 were codon optimized for bacterial expression and cloned into a pET26b expression in frame with pelB and His6 sequences using clone EZ service from GenScript. The production and purification of Nb6E (previously named VHH05 ...
-
bioRxiv - Neuroscience 2023Quote: The pFlpStop2.0-attB-UAS-2.1-tdTom plasmid was generated through the synthesis of the FlpStop 2.0 cassette (Figure 3A) and molecular cloning into the FlpStop-attB-UAS-2.1-tdTom124 by Genscript (Piscataway, NJ, USA). Constructs were sequence-verified by single primer extension (Sequetech ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthetic cut7 alleles (Genscript) were inserted into pMB64 ...
-
bioRxiv - Bioengineering 2023Quote: ... and purification was performed with an AmMag™ SA Plus Semi-automated System (Genscript) using PBS as running buffer and carrying out washing steps with PBS 4 mM Imidazole ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Bioengineering 2023Quote: ... Loaded beads were then fished out from the expression media using an AmMag™ magnetic wand (Genscript) and purification was performed with an AmMag™ SA Plus Semi-automated System (Genscript ...