Labshake search
Citations for GenScript :
1751 - 1800 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... A plasmid containing mouse Pax1 (GenScript; OMu21524) was used as template for DIG-labeled probes ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant PDC-E2-ILD was manufactured by Genscript (Piscataway, NJ) using its proprietary E ...
-
bioRxiv - Immunology 2023Quote: ... was constructed based on the sequence Fc.Mut24 published by Khoryati et al.13 The protein was manufactured by Genscript, using its proprietary CHO mammalian expression system ...
-
bioRxiv - Microbiology 2023Quote: ... Custom synthesized DNA (GenScript, Piscataway, NJ) bearing the N- and C-terminal mutations were amplified with dcas9_mut1_ F/R and dcas9_mut2_F/R (Supplemental Data 1).
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Microbiology 2023Quote: ... double-stranded GBS-optimized sgRNA cassette (Genscript custom order) with an upstream xyl/tet promoter that constitutively expresses the sgRNA ...
-
bioRxiv - Immunology 2023Quote: ... and rhPCSK9 sequences rhPCSK9153-163 (SIPWNLERITP) and rhPCSK9207-223 (SVPEEDGTRFHRQASKC; the same as the mPCSK9207-223 sequence) were synthesized by GenScript. PCSK9153-163 peptides were modified with a C-terminal cysteine residue preceded by a 3-glycine-spacer sequence (-GGGC ...
-
bioRxiv - Microbiology 2023Quote: ... which was detected using an affinity-purified rabbit polyclonal anti-ORF59 antibody that was generated (GenScript, Piscataway, NJ, USA) against the peptides GKKTRGGNKASDSGT and KRPPPKKDREPTTKRPKL ...
-
bioRxiv - Microbiology 2023Quote: The cDNA copies encoding the HA1 consensus or mutant sequences were synthesized by Genscript (Piscataway, NJ, USA) and then sub-cloned into the plasmid pDP-BsmbI-WF10_HA2 encoding the HA2 portion of WF10 ...
-
bioRxiv - Neuroscience 2023Quote: VEGF120 and VEGF164 were synthesized by Genscript using the known sequences of mouse VEGF120 and VEGF164 cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... and genes were synthesized by Genscript Corporation (Nanjing ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were resolved in an ExpressPlus 4-12% gradient gel (GenScript), electroblotted to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2023Quote: The oligonucleotides used in this study were synthesized by Genscript Company ...
-
bioRxiv - Molecular Biology 2023Quote: ... All plasmids were constructed by Gibson assembly or purchased from Genscript. Oligonucleotide primers for Gibson assembly were designed using the NEBuilder 2.0 web tool and are included in Supplementary Table S2S6 ...
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were boiled for 5 minutes with 100 mM DTT and 1X LDS buffer (GenScript M00676) and run on NuPAGE 4-12% Bis-Tris gels (Thermo NP0335BOX ...
-
bioRxiv - Bioengineering 2023Quote: MS-Hu6 (Lot No. RO210015845) was provide by Genscript. Sodium chloride ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by PCR using primers 1941 and 1942 and as a template the clone in PD912-GAP which was obtained from Genscript, Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: ... To generate a destination vector for the DHFR-PCA, a Gateway cassette was inserted at the C-terminus of DHFR[F3] in pGJJ045 (Faure et al., 2022) (Genscript). GCK was cloned into the pDEST-DHFR-PCA destination vector using Gateway cloning (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-cast gradient gels (4-20 %) were purchased from GenScript (Piscataway, NJ). Electrophoresis was performed using a Bio-Rad SDS-PAGE gel analysis casting system (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biochemistry 2023Quote: The synthetic genes encoding Cyt-b5 and FBD were purchased from GenScript and subcloned into pET28a(+ ...
-
bioRxiv - Bioengineering 2023Quote: ... The variable regions of M2 and M6 hybridomas were sequenced after generating cDNA internally or by GenScript with permission from Dr ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... coli and purified by GenScript. The final size of the protein including tags is 30.7 kDa ...
-
bioRxiv - Cell Biology 2023Quote: PLIN1 and APEX2-V5 fragments were amplified by PCR from PLIN1 cDNA ORF clone in pcDNA3.1+/C-(K)-DYK vector (GenScript: OHu22113) and Twinkle-APEX2-V5 vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... transferred into tubes containing FLAG resin (GenScript), and rotated for 2 hrs at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Synthetic peptides were ordered from GenScript with a carboxylated N-terminus and acetylated C-terminus (N-Cadherin Sequence ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Fluorescein-labelled and crosslinker peptides were obtained from Genscript (Piscataway, NJ) in lyophilized form ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted between Lys359 and Met360 in the TM3-TM4 intracellular loop of the β2 subunit by using the GenBuilder cloning kit (GenScript, catalog #: L00701), as previously described 17 ...
-
bioRxiv - Biophysics 2023Quote: The plasmids for the expression of codon optimized versions of G4Ps and variants with N-terminal FLAG-His tags in the pET28a backbone were synthesized by GenScript.
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Cell Biology 2023Quote: DmMIC26-Spot (GenScript) was amplified by PCR using the oligonucleotides 48/49 ...
-
bioRxiv - Cell Biology 2023Quote: Humanized DmMIC10b-FLAG flanked by AgeI and EcoRV restriction sites (obtained from GenScript) was inserted into the AgeI/EcoRV restriction sites of AAVS1-TRE3G-Mic10-FLAG-T2A-EGFP (T ...
-
bioRxiv - Cell Biology 2023Quote: DmMIC19-Spot (GenScript) was amplified by PCR using the oligonucleotides 50/51 ...
-
bioRxiv - Cell Biology 2023Quote: Humanized DmMIC10b-FLAG (GenScript, Piscataway Township, NJ, USA) was amplified by PCR using the nucleotides 26/27 and inserted into the HindIII and XhoI restriction sites of pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with either anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Cell Biology 2023Quote: ... anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-HA antibody conjugated to iFluor 647 (GenScript A01808) at 1:1,000 were used ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... and sequence verified by GenScript (Piscataway, NJ), which also performed plasmid preparation services to provide transfection grade DNA ...
-
bioRxiv - Biophysics 2023Quote: ... all synthesized from GenScript Biotech ...
-
bioRxiv - Biophysics 2023Quote: ... purified using anti-Flag resins (GenScript Biotech), and further purified using Heparin and size-exclusion chromatography (Superose 6 ...
-
bioRxiv - Biophysics 2023Quote: The binding affinities of wild-type Clr6S and Rpd3S proteins to the synthesized H3K36me3 peptide (ATKAARKSAPATGGVK36(me3)KPHRYRPG) (GenScript Biotech) were determined using BIAcore T200 system (GE Healthcare ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...