Labshake search
Citations for GenScript :
1701 - 1750 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and C211 (CFRTLKLATPTYGDL) were chemically synthesized by Genscript (USA) (HPLC purified ...
-
bioRxiv - Cell Biology 2023Quote: The anti-phospho BRCA1 antibody was raised and purified by GenScript against phosphorylated peptide CQSESQGVGL{pSer}DKEL.
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-VHP-sequon-VHP-K20-GFP-HA was ordered as a gene block (Genscript) and inserted into a pcDNA3.1 parent vector containing a CMV promoter ...
-
bioRxiv - Biophysics 2023Quote: The plasmid DNA encoding the different A-IDP sequences in pQE80L cloning vectors was purchased from Genscript Corporation (Piscataway ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a protease-cleavable peptide (KKCG-GPQGIWGQ-GCKK, Genscript). HA-RGD gels were crosslinked with peptide crosslinkers at varying ratios to yield hydrogels with a shear modulus ∼300 Pa and a final 1.5 wt ...
-
bioRxiv - Cell Biology 2023Quote: The full length of TgREMIND DNA sequence and those of its N-terminus F-BAR and C-terminus REMIND domains were synthesized and cloned into the pGEX plasmid by GenScript using the restriction enzymes BamHI and NcoI ...
-
bioRxiv - Immunology 2023Quote: ... standard curves were generated using a synthetic plasmid containing a segment of the E-gene (GenScript) and interpolation was performed as described by Feld et al.71 ...
-
bioRxiv - Immunology 2023Quote: ... followed by a Kpn1 restriction site and the poly-A signal “TCTAGACTCGACCTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTG GAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTGCGGCC GCGATATC” (GenScript, Piscataway, NJ, USA). The gene cassette was flanked by Bgl2 sites and synthesized by Integrated DNA Technologies (Coralville ...
-
bioRxiv - Immunology 2023Quote: Neutralizing antibodies were assessed using the cPass SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript) according to manufacturer’s instructions with the following changes ...
-
bioRxiv - Genomics 2023Quote: The SncmtRNA full-length cDNA sequence was synthesized by Genscript Inc ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Genetics 2023Quote: Antibodies to all kinetochore proteins used in this study were custom-produced by GenScript (Piscataway, NJ, USA) or Biomatik (Cambridge ...
-
bioRxiv - Genomics 2023Quote: ... The 500 bases long ssDNA donor (gift from GenScript) contained the U6 promoter-driven EGFP-Cr1 sgRNA expression cassette and the ROSA26 homology arms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Immunology 2023Quote: ... All other peptides were synthesized to 90% purity by Genscript (USA)
-
bioRxiv - Immunology 2023Quote: ... TAP1 deficient 221-C*08:02 cells were generated by expression of HLA-C*08:02 in 221-Cas9 cells followed by transduction with two gRNA targeting TAP1 (Genscript)42 ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding HLA-C*05:01 (1-278) and β2M (1-99) were synthesized and cloned into pET30a by Genscript and were previously described42 ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Genetics 2023Quote: The eG-SCON-FRT-FP cassette was ordered from Genscript, and subsequently cloned into pcDNA4/TO ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids pML107 11 or PAEF5 12 carrying gRNA were co-transformed with 200bp DNA repair recombinant donor sequences carrying telomeric repeats seeds (Genscript Biotech Netherlands) (Figure Supp 1A).
-
bioRxiv - Genetics 2023Quote: ... mutans cultures were diluted 1:40 from overnight cultures and grown to an optical density of OD600 ∼0.1 in THYE before the addition of transforming DNA and 1 μg ml−1 Competence Stimulating Peptide (CSP; GenScript). The cultures were subsequently incubated for an additional 2 h and then plated on antibiotic-supplemented THYE plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... The probe design software can be found on https://github.com/BoettigerLab/ORCA-public.The probe library was ordered from CustomArray (now operated by Genscript) as an oligo pool.
-
bioRxiv - Developmental Biology 2023Quote: Immunoblot was performed according to a standard procedure using 4%-20% gradient SDS polyacrylamide gels (Genscript). Cells were directly lysed in 4X Laemmli gel loading buffer (Boston BioProducts) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and BsiWI-T2A-GAL4DBD_AscI by GenScript (Piscataway, USA). The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and BsiWI-T2A-VP16_AscI by GenScript (Piscataway, USA). The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957 ...
-
bioRxiv - Immunology 2023Quote: ... R22E (SHLVEALYLVAGEEG) and E21G/R22E peptides (SHLEVALYLVAGGEG) were purchased from GenScript. 2.5HIP (DDLQTLALWSRMDQLDD ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Immunology 2023Quote: ... psPAX2 (Genescript) and STX-S_pLenti (Genscript) expressing spike or STX-N_pLenti (Genscript ...
-
bioRxiv - Immunology 2023Quote: ... expressing spike or STX-N_pLenti (Genscript) expressing nucleocapsid using Lipofectamine 3000 according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Developmental Biology 2023Quote: ... then 4 × LDS sample buffer (GenScript, M00676-10) was added ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEFL homology arm (HA)_1 fragment (Genscript) was cloned into the AAVS1_3xFLAG-6xHis vector at the Nde1/NcoI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The HA_2 fragment (Genscript) was then ligated to the AAVS1_3xFLAG-6xHis-HA_1 vector at the BstBI/EcoRI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... and supernatants were incubated with anti-DYKDDDDK G1 Affinity beads (Genscript; L00432-10) or anti-GFP magnetic beads (Bio-Linkedin ...
-
bioRxiv - Immunology 2023Quote: ... Immunoblotting experiments were performed using 20 µg of total proteins per lane loaded on Precast SDS gels (Genscript). After electrophoresis ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was acquired from GenScript (Piscataway, NJ). For the generation of a codon-optimized bacterial expression construct ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was also acquired from GenScript. This cDNA was subsequently cloned in-frame into the EcoRI and SalI sites of the pGST-Parallel-1 vector (Sheffield et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and synthetic genes were purchased from GenScript. All four ORFs were insertent to a GoldenBac plasmid (pGB ...
-
bioRxiv - Cell Biology 2023Quote: To generate GFP-TBK1 constructs the insect codon optimized TBK1 gene was purchased from GenScript and cloned with respective tags into pFastBac_Dual (Table S4) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCC7001 (IMG ID: 647590134, CPCC7001_1784 and IMG ID: 647590133, CPCC7001_1671, respectively) were synthesized (GenScript, New Jersey, USA) and inserted into the SacI/XbaI restriction sites of plasmids pSE2-1 and pSE4-1 which both carry a spectinomycin resistance (spR ...
-
A balance between pro-inflammatory and pro-reparative macrophages is observed in regenerative D-MAPSbioRxiv - Bioengineering 2023Quote: ... the cross-linker solution was prepared by dissolving the di-thiol matrix metalloproteinase sensitive peptide (Ac-GCRDGPQGIWGQDRCG-NH2, GenScript) in distilled water at 12 mM and reacted with 10 μM Alexa-Fluor 647-maleimide (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Genes encoding pyocin SX1 and SX2 and associated immunity proteins (GenBank records ON716475-ON716476) were codon optimized and synthesized (GenScript, USA) for expression in E ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein was quantified using a BCA assay and 50 μg of each sample was prepared for loading onto 12% precast PAGE gels (GenScript). Wet transfers were performed onto 0.45 uM pore-sized PVDF membranes (Immobilon) ...
-
bioRxiv - Microbiology 2023Quote: ... Novel plasmids were synthesized by Genscript (Piscataway, NJ, USA). We built a FVV expressing β-galactosidase with a nuclear localization signal (puc2MD9-B-GAL ...
-
bioRxiv - Microbiology 2023Quote: Plasmid pBLS820 was custom produced by GenScript (Piscataway, NJ) by cloning the B ...