Labshake search
Citations for GenScript :
501 - 550 of 804 citations for Recombinant Human LILRA3 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... A pET28a(+) plasmid containing an open reading frame for human hnRNPA1 with an N-terminal 6xHis tag was synthesized by GenScript. The 6xHis-hnRNPA1 was expressed in E ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Biochemistry 2024Quote: ... the RBD and subdomain-1 (RBD-SD1, residues 307-675) and human TMPRSS2 (residues 107-492, NCBI accession O15393) were obtained from Genscript. Cloning and mutagenesis of those genes were also performed by Genscript ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding full length human systemic RNAi-defective transmembrane family member 1 (hSIDT1) was synthesized by GenScript and was then cloned into the pEG BacMam expression vector to be expressed via baculoviral transduction in HEK293S GnTI− cells as a fusion protein containing a C-terminal GFP-Strep-tag-II for large scale protein expression [49] ...
-
bioRxiv - Biochemistry 2023Quote: S- and MB-COMT cDNA were codon optimised for expression in human cells and inserted into an integrative VAMP-seq expression vector (Matreyek et al., 2018) fused to GFP (Genscript). Singlesite variants were generated by Genscript ...
-
bioRxiv - Cell Biology 2023Quote: ... residues 1-77) and human STX4 (lacking the transmembrane domain; residues 1-271 with 272C) were generated as synthetic genes (Genscript) with codon optimization for human expression ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cDNA of pMag, pbF, and Dkk1c (the C-terminal domain of human Dkk1, residues 177-266) were synthesized by Genscript. The plasmid constructs pMag-pbF and RRP-Dkk1c ...
-
bioRxiv - Immunology 2023Quote: Antibody binding was also assayed by flow cytometry using CHO-K1 and CHO-K1 Fut8 KO cells transfected with a human PD-1 plasmid (GenScript) by lipofectamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: All constructs for human expression were generated through custom synthesis and subcloned into a pcDNA3.1 backbone by Genscript (Piscataway, USA). All constructs for GFP expression in E ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biochemistry 2023Quote: ... was inserted into the N-terminus of human AGO2 using CRISPR/cas9 in WT HCT116 cells carried out by GenScript. The SV40 NLS amino acid sequence is PKKKRKVAG ...
-
bioRxiv - Biochemistry 2023Quote: Human full-length wild-type DNA Pol β was overexpressed from a PET-28a codon optimized clone purchased from GenScript in the BL21-CodonPlus(DE3)-RP E ...
-
bioRxiv - Biochemistry 2023Quote: The full-length cDNAs for human SIDT1 and SIDT2 (Uniport: Q9NXL6 and Q8NBJ9, respectively) were codon-optimized and synthesized by GenScript Co. ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Biochemistry 2023Quote: The DBC1-NHD fragment (residues 354-396) derived from the human DBC1 (Uniprot code: Q8N163) was synthesized and subsequently cloned into the pETM41 vector by GenScript Biotechnology Co. ...
-
bioRxiv - Cell Biology 2023Quote: DNA sequences that encode the wildtype amino acid sequence of human ABHD17B and encode a mutation of Ser 170 to Ala in ABDH17B were synthesized by GENScript. The cDNAs also contain identical additional nucleotide modifications that do not affect amino acid sequence (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2024Quote: Human Mb constructs (WT Mb, Mb K46M) were cloned into pET28a(+) vectors with bacterially optimized codons and purchased from GenScript Biotech Corp ...
-
bioRxiv - Biophysics 2024Quote: DNA constructs encoding the amino acid sequences of the human Panx1 (hPanx1: gene ID: 24145) and frog Panx1 (frPanx1: 100170473) were synthesized (GenScript) and subcloned into appropriate vectors using a standard molecular cloning techniques ...
-
bioRxiv - Immunology 2024Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the RBD gene fragments ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: The proteins were codon optimized for eukaryotic expression and de novo synthesized by GenScript.
-
bioRxiv - Plant Biology 2019Quote: ... 1:500 (produced for this study using full length protein as antigen by GenScript); α-Actin ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Immunology 2024Quote: ... and then supernatants containing monoclonal antibodies were purified by Protein A magnetic beads (Genscript). The purified mAb samples were verified by SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: FLOE1 and derived mutant constructs for expression in human cells were optimized for human expression (Table S3) and generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA).
-
bioRxiv - Cell Biology 2021Quote: PopZ and derived mutant constructs for expression in human cells were generated through custom synthesis and subcloning into the pcDNA3.1+N-eGFP backbone by Genscript (Piscataway, USA). The mCherry-G3BP1 plasmid was a kind gift of Dr ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.