Labshake search
Citations for GenScript :
501 - 550 of 1133 citations for Dengue Virus Serotype 3 Envelope Protein Human Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Cell Biology 2023Quote: ... human NAP1 cDNA was synthesized and cloned in a pcDNA3.1 vector (Genscript), from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human Flag-TMX2 (pIRES2-EGFP) were constructed by Genscript (Piscataway, NJ). Dog Flag-Calnexin was previously described (Lynes et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Selected small proteins and small protein derived peptides from high-and medium observed abundance were chemically synthesized (Genscript) and subjected to LC-MS/MS as above ...
-
bioRxiv - Microbiology 2020Quote: ... and purified with protein A resin (GenScript) and by Ni-NTA resin (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and biotinylated Protein A mixture (GenScript #M00095) was diluted 42 fold to 240 nM in 1x PBS with 0.0025% Tween 20 ...
-
bioRxiv - Cell Biology 2020Quote: ... NeutrAvidin and biotinylated Protein A (GenScript #M00095) were mixed in a 1:1 ratio to a final concentration of 10 μM and stored at 4 °C ...
-
bioRxiv - Genomics 2019Quote: ... Protein was generated by GenScript (Piscataway, NJ) and purified to >80% purity ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.2 mg/mL Protein C peptide (Genscript) and 5 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: Commercial recombinant proteins: rhIL11 (UniProtKB: P20809, Genscript), rmIL11 (UniProtKB ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090.
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/ml protein C peptide (Genscript), and 30 µM ‘8090 ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein A Sepharose (GenScript Biotech, Piscataway USA) was used to precipitate complexes by adding a 50% slurry and incubating for further 2 h ...
-
bioRxiv - Immunology 2021Quote: Purified SARS-CoV-2 S1 protein (GenScript) in carbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... Biotin-Protein L was purchased from GenScript. BsiWI was purchased from New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Cancer Biology 2022Quote: ... and purified with protein A resin (GenScript). Buffer replacement in protein purification used Column PD 10 desalting column (GE Healthcare) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PAGE-MASTER Protein Standard Plus (GenScript), 5 μL in both cases ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli protein expression and synthesized by GenScript, USA before being cloned into the pETDuet-1 vector ...
-
bioRxiv - Immunology 2023Quote: Recombinant SFB3340 protein was procured from GenScript, biotinylated at 1:1 ratio using EZ-Link™ Sulfo-NHS-LC-Biotin (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: All proteins were custom-made by GenScript HK Limited ...
-
bioRxiv - Microbiology 2024Quote: Natural IgM and IgG were purified from normal murine serum using Protein G and Protein L resin (GenScript, China) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Biophysics 2024Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... Cdc42 and WAS-GBD were human codon-optimized and gene-synthesized by Genscript and inserted into the pCAGGS plasmid using an NEBuilder assembly kit ...
-
bioRxiv - Biochemistry 2020Quote: ... BG505 SOSIP.v4.1 expression constructs in which all PNGS were mutated to either NxT (NxT protein) or NxS (NxS protein) were obtained from Genscript and cloned in the pPPI4 expression vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The anti-Mps1 antibodies were generated in rabbits against a recombinant Mps1 protein fragment (residues 440-764) of the protein by Genscript. The company provided affinity purified antibodies that we validated by purifying kinetochores from yeast strains with Mps1 or Mps1-13Myc and confirming that the antibody recognized a protein of the correct molecular weight that migrated more slowly with the 13Myc epitope tags ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-Scm3 antibodies were generated in rabbits against a recombinant Scm3 protein fragment (residues 1-28) of the protein by Genscript. The company provided affinity-purified antibodies that we validated by immunoprecipitating Scm3 from yeast strains with Scm3-V5 and confirming that the antibody recognized a protein of the correct molecular weight that was also recognized by α-V5 antibody (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Molecular Biology 2022Quote: ... All custom recombinant proteins were synthesised by GenScript using a mammalian expression system.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Immunology 2019Quote: Recombinant microbial protein synthesis was performed by Genscript Corporation (http://www.genscript.com/ ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with recombinant protein (GenScript, Sigma, Tocris) of each analyte for 4 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membrane (Genscript) by the Genscript eBLOT L1 fast wet protein transfer system ...
-
bioRxiv - Microbiology 2020Quote: ... The protein was cleaved using bovine enterokinase (GenScript) leaving a FLAG-tag at the C-terminus of the RBD ...