Labshake search
Citations for Takara Bio :
1 - 50 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Zoology 2023Quote: ... Primers were designed on each contig (Table S3) and RT-PCR was performed using a 3’ RACE CORE Set (Takara Bio).
-
bioRxiv - Immunology 2022Quote: ... added with RT-PCR master mix and IgG VH/VL primers per well and performed with RT-PCR following the one step RT-PCR kit protocol (Takara, RR057A). Then ...
-
bioRxiv - Cancer Biology 2019Quote: ... and specific primer sets (Takara Bio), as described in a previous report (Inui et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... The full-length cDNA of the human ZNRF3 was acquired from the human CRC DLD-1 cell line by RNA purification using NucleoSpin RNA II kit (Macherey Nagel) and reverse transcription RT-PCR using specific primers and Primescript RT reagent kit (TaKaRa). Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... Transformants were screened by colony PCR using the primer set JT37/JT38 and Sapphire polymerase (Takara Bio), and positive clones were selected for outgrowth ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reactions were performed with gene-specific forward and reverse primers using the PrimeScript RT-PCR kit (TaKaRa) on the StepOne Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mitochondrial DNA monitoring primer set kit from Takara Bio [San Jose ...
-
bioRxiv - Cell Biology 2021Quote: ... The Human Mitochondrial DNA Monitoring Primer Set (TaKaRa, Cat # 7246) was used to determine mitochondrial DNA (mtDNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... for S100a9 with a primer set (MA058882) obtained from TaKaRa Bio Inc ...
-
bioRxiv - Genomics 2021Quote: ... Target regions were amplified by PCR using specific primer sets and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). Sanger sequencing was performed using BigDye Terminator reactions and loaded onto a 3730xl DNA analyzer (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... 20-50ng of the first PCR amplicon in a total PCR reaction volume of 25ul was amplified in a 12 cycle PCR using primer set 2 and PrimeSTAR GXL DNA Polymerase (Takara) (Supplemental Table 1b) ...
-
bioRxiv - Biochemistry 2021Quote: ... Polymerase chain reaction (PCR) was performed using the primer set Fish-F1 and Fish-R229 and Tks Gflex DNA polymerase (Takara, Japan). The PCR product was directly sequenced at Macrogen Inc ...
-
bioRxiv - Cell Biology 2020Quote: Reverse transcription-PCR (RT-PCR) was performed using the PrimeScript RT Reagent Kit (TaKaRa). Quantification of mRNA level was performed in a 20 μl mixture consisting of 10 μl Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by RT-PCR using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa) with primers no ...
-
bioRxiv - Molecular Biology 2022Quote: ... by RT-PCR (TaKaRa, RR014) and cloned by Gibson assembly into the vector pK27SUMO (expressing a 14His-tagged version of the yeast SUMO protein Smt3 ...
-
bioRxiv - Microbiology 2021Quote: ... Comparative RT-PCR (Takara, Japan) was performed using SYBR Green Supermix via an RT-PCR machine (RocheLightCycler480 ...
-
bioRxiv - Biochemistry 2023Quote: ... by RT-PCR (Takara, RR014) and cloned by Gibson assembly into the vector pK27SUMO ...
-
bioRxiv - Cell Biology 2020Quote: ... nested PCR was performed using PCR Mycoplasma Detection Set (Takara, 6601).
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Cell Biology 2023Quote: ... as per manufacturer’s protocol.The expression profile of target gene was evaluated using specific primers by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Microbiology 2023Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Microbiology 2019Quote: ... and reverse transcription-PCR (RT-PCR) was carried out with a PrimeScript RT reagent kit (TaKaRa). The primers used for RT-PCR are listed in Table 3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-PCR kit (Takara, Tokyo, Japan) was used to construct reverse transcription to collect cDNA ...
-
bioRxiv - Systems Biology 2020Quote: ... RT-PCR was performed using PrimeScript RT Master Mix (DRR036A, TakaRa) and qPCR was performed by qPCR SYBR Green Master Mix (11198ES03 ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed with the PrimeScript RT Reagent Kit (TaKaRa) and the primers listed in Table 2 ...
-
bioRxiv - Zoology 2019Quote: ... Gene specific primers listed in supplementary information were used in quantitative RT-PCR reactions containing SYBR green master mix (Takara #RR820). The Ct values were used to calculate Fold Change against spike-in control lncRNA (see results for details ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Microbiology 2021Quote: ... and MSN4 were measured by RT-PCR using One Step SYBR PrimeScript RT–PCR Kit II (TaKaRa). Reactions were run on Mx3005P qPCR System (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNA used for qRT-PCR were synthesized using PrimeScript reverse transcriptase with oligo dT primer and Prime Script RT Enzyme MIX I (Takara, Osaka, Japan). qRT-PCRs was performed using the ChamQ SYBR Color qPCR Master Mix (Q411 ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Immunology 2020Quote: ... q-RT-PCR was performed using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time; TaKaRa). The primers used for q-RT-PCR were selected to be specific for the E and ORF1ab sequences in the SARS-CoV-2 genome (Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes 55 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using One Step PrimeScript RT-PCR Kit (Takara, Japan) with the following primers and probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM, Clontech) with KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Microbiology 2021Quote: ... UK) containing the 27F/1492R primer set and MightyAmp DNA polymerase Ver.3 (Takara Bio). PCR was performed according to a previous report (Fujiyoshi et al ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time; Takara, Japan) and Thermal Cycler Dice® Real Time System Lite (TP700 ...
-
bioRxiv - Microbiology 2023Quote: ... and were quantified by real-time RT-PCR using One Step TB Green PrimeScript RT-PCR Kit II (Perfect Real Time) (TaKaRa) and QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... covering SIV env and nef were amplified from plasma viral RNA by nested RT-PCR using Prime-Script one-step RT-PCR kit v2 (TaKaRa) and KOD-Plus v2 (Toyobo) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RT-PCR was performed to detect sorcs2 mRNA in wt embryos using the Titanium One-Step RT-PCR kit (Clontech) with primers 5’-TTTTGCGCACCTGTACCCAGCTG-3’ and 5’-TAACGCGCTCCTGAAGCAGAGTC-3’ for detection of mRNA after injection of different amounts of sMO and 5’-TTTTGCGCACCTGTACCCAGCTGTGTT-3’ and 5’ TAACGCGCTCCTGAAGCAGAGTCCATT-3’ for the different developmental stages ...
-
bioRxiv - Pathology 2023Quote: ... and reverse transcribed using PrimeScript RT Master Mix for RT-PCR (Takara Bio, Japan). Real-time PCR was performed using SYBR Select Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... One-Step PrimeScript RT-PCR Kit (Takara, RR064) was utilized for qRT-PCR (probe ...