Labshake search
Citations for Takara Bio :
1 - 50 of 75 citations for dNTPs since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... dNTP (Takara, Japan), DNase (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... dNTP (Takara Bio), and the primers designed for the above-mentioned FWA regions (see Supplementary Table 5 ...
-
bioRxiv - Plant Biology 2023Quote: ... dNTP (Takara Bio), and the primers designed for the above-mentioned FWA regions (see Supplementary Table 5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 200uM dNTPs (Takara), 250nM primer-F ...
-
bioRxiv - Plant Biology 2023Quote: ... dNTP (Takara Bio), and the primers designed for the above-mentioned FWA regions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 μL of 25 mM Dntp (Advantage UltraPure dNTP Combination Kit) (TaKaRa), 4.0 μL of 5× SSIV Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (Clontech), 1 U/mL RNase inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.5 mM dNTPs (Takara), and ERCC Mix 1 (Thermo-Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTPs (Takara), and ERCC Mix 1 (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM dNTPs (Clontech), 1 U/mL RNase inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... 10mM dNTP (Takara, Japan), 0.1M DTT (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3mM dNTP mix (Takara Bio)) ...
-
bioRxiv - Microbiology 2021Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Bioengineering 2022Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (Clontech, #639125), 1 U/μL Rnase Inhibitor (Lucigen ...
-
bioRxiv - Genomics 2021Quote: ... 800 µL of dNTPs (Takara), 50 µL of P5 stagger primer mix (stock at 100 µM concentration) ...
-
bioRxiv - Genetics 2020Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 800□μL of dNTPs (Takara), 50□μL of P5 stagger primer mix (100□μM) ...
-
bioRxiv - Genomics 2023Quote: ... 800 μL of dNTPs (Takara), 50 μL of P5 stagger primer mix (stock at 100 μM concentration) ...
-
bioRxiv - Microbiology 2023Quote: ... dNTPs and reverse transcriptase (Takara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... dNTPs and reverse transcriptase (Takara) as per manufacturer’s protocol.The expression profile of target gene was evaluated using specific primers by using SYBR green RT-PCR master mix (Takara ...
-
bioRxiv - Genomics 2023Quote: ... 800 uL of dNTPs (Takara), 50 uL of P5 stagger primer mix (stock at 100 uM concentration) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4μl dNTP (2.5mM; Takara, #R050B), 1μl Partial R1 – CTACACGACGCTCTTCCGATCT (10μM) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 800 μl of dNTP (Takara Bio), 50 μl of P5 primer (stock at 100 μM concentration) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 mM dNTPs (Takara Bio, #639125), 4 mM MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and accompanying dNTPs (Takara, cat# RR01BM) were used.
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.5 μL of 2.5 mM dNTPs (Takara), 0.25 μL of 10 μM IS PCR primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μL of 10 mM dNTPs (Takara), 1 μL of 10 μM TSO primer (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1.6 μL dNTP (TAKARA, Cat. No. 4030), 0.32 μL DIG-11-dUTP (25 nmol ...
-
bioRxiv - Genomics 2019Quote: ... 10 µl of 10 mM dNTPs (Clontech #639125), 2.5 µl RNase Inhibitor (Lucigen) ...
-
bioRxiv - Genomics 2021Quote: ... 11 µL of 10 mM dNTP (Takara, #639125), 13.75 µL of ultra-pure water and 2.75 µL of RNase Inhibitor (Fisher ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μM deoxynucleotide triphosphates (dNTPs, Takara, CA, USA), 1 μg μL-1 BSA (Simplebiotech GmbH ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 mM dNTPs (Takara Bio USA, Madison, WI), 2 mM of each primer (final concentrations) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5µM ISPCR Primer and 7.5mM dNTP mix (Takara Bio). PCR amplification was performed in a thermal cycler (BIORAD C1000 Touch Thermal Cycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... with 250 μM deoxy nucleoside triphosphate (dNTP, Takara Bio) concentration ...
-
bioRxiv - Genomics 2021Quote: ... 5 μL of 2.5 mM dNTPs (Takara Bio Inc.), 1 μL of 20 μM TruSeqUniv (Supplementary Table S7) ...
-
bioRxiv - Genomics 2019Quote: ... 0.4-mM dNTP Mix (50X/10 mM, Clontech, 639206), 0.48-μM IS PCR Primer (12 μM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.8 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.8 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.8 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.64 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.8 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.8 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.4 µL of 10 mM dNTPs (Takara #4030), with the following thermal cycle condition ...