Labshake search
Citations for Takara Bio :
1 - 50 of 684 citations for Tripartite Motif Containing 22 TRIM22 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Cellartis® human iPSC line 22 (ChiPSC22) was obtained from Takara, expanded and cultured using Cellartis DEF-CS Culture System following Cellartis protocol.
-
bioRxiv - Systems Biology 2020Quote: ... A second 22-cycle PCR was performed with PrimeSTAR HS polymerase (Takara) in 20 125 μL reactions ...
-
bioRxiv - Neuroscience 2019Quote: Neurons at 22 DIV were transfected with an eGFP-N2 plasmid (Clontech, Kyoto, Japan) using Lipofectamine 2000 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Physiology 2024Quote: ... cDNAs were subcloned into pGEMHE (22) using the In-Fusion Snap Assembly Master Mix (Takara Bio, Shiga, Japan) with gene-specific primers and 15-bp sequences complementary to the ends of the linearized pGEMHE (Table S4 ...
-
bioRxiv - Microbiology 2020Quote: ... The transgenes were inserted between the P and M gene of pNDV LaSota (LS) wild type or the L289A (15, 22, 23) mutant (NDV_LS/L289A) antigenomic cDNA by in-Fusion cloning (Clontech). The recombination products were transformed into NEB® Stable Competent E ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Neuroscience 2022Quote: ... washed with 200 µL water, and resuspended in PCR mix (22 µL water, 25 µL Terra PCR direct buffer, 1 µL Terra Polymerase (Takara), 1 µL 100 M Truseq PCR handle primer ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA synthesis and subsequent cDNA amplification by 22 cycles of polymerase chain reaction (PCR) were performed using the SMARTer stranded RNA-seq kit (Takara). The synthesized first-strand cDNA and amplified cDNA were purified using Ampure XP Beads (Beckman Coulter) ...
-
bioRxiv - Neuroscience 2022Quote: ... Beads were resuspended in 200 uL Template Switch mix (88 uL water, 44 uL 5x Maxima buffer, 44 uL 20% Ficoll PM-400, 22 uL 10 mM Takara dNTPs ...
-
bioRxiv - Plant Biology 2023Quote: ... the strain carrying the pLBD16::AbAi bait was tested for autoactivation by using empty prey strains carrying empty vector of pDEST-22 under various concentrations of Aureobasidin A (AbA) (Takara) (0 ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... was constructed similarly by placing the HRAS-CAAX box motif on the C-terminus of EGFP in the pEGP-C1 vector (Clontech). The RFP-Myo10 construct was prepared by cloning mApple (from Addgene No ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Neuroscience 2022Quote: ... Incubation with primary antibodies was performed in blocking buffer containing rabbit anti-DsRed (1:1000, 632496; Clonetech-Takara Bio, Japan) antibody at 4°C for 1–2 days ...
-
bioRxiv - Plant Biology 2020Quote: ... The RAV1 motif enriched promoter sequence of each of the gene (Table S1) was cloned in pAbAi bait vector (Clontech, USA) in the upstream of Aureobasidine A ...
-
bioRxiv - Bioengineering 2020Quote: ... genes encoding CAR constructs were purchased as gblocks (IDT) (21, 22) and amplified by PCR and cloned into the pCDH vector using Infusion cloning tools (Takara Bio, Kusatsu, Japan). Sequences for all clones used in subsequent experiments were confirmed by sequencing ...
-
bioRxiv - Neuroscience 2020Quote: ... containing lysis buffer (containing dNTP [2.5 mM], oligo-dT [2.5 mM], RNAse Inhibitor [Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ChIP-seq libraries were generated from ChIP-DNA using a custom Illumina library type on an automated system (Apollo 342, Wafergen Biosystems/Takara, Active Motif). ChIP-seq libraries were sequenced on Illumina NextSeq 500 as single-end 75bp reads (Active Motif).
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Immunology 2020Quote: ... containing X-gal (Takara Bio) and ampicillin (Sigma–Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions containing 1x premix (Takara), 0.5μM forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing RNAase inhibitor (Takara Bio, 2313B) and incubated for 15min ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing RNAse inhibitors (Takara Bio, #2313) to release mRNAs into solution ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Plant Biology 2023Quote: ... The promoter sequence with and without mutation in ZDRE motif were artificially synthesized and cloned into the Kpn I-linearized pAbAi vector (Clontech Laboratories, Inc., Kusatsu, Japan) to generate the bait vectors ...
-
bioRxiv - Neuroscience 2021Quote: ... floating coronal sections were rinsed in PBS and blocked for 1–2 hr at room temperature in a solution of 10% normal goat serum and 0.5% Triton X-100 dissolved in PBS and then incubated in blocking solution containing rabbit anti-DsRed polyclonal antibody (1:1000; Takara Bio, Mountain View, CA) with gentle agitation at 4°C for 18–22 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments containing pLib vector backbone (Clontech) and EF1A promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were incubated in a blocking buffer containing the primary antibodies rabbit anti-mCherry (1:1500; cat. No. 632496, Takara Bio USA, Inc., Mountain View, CA, USA) and chicken anti-GFP (1:1500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were sorted into 96-well plates containing 4uL lysis buffer containing 4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 × 104 SH-SY5Y cells in 90 µL of growth media containing no antibiotics were plated in opaque TC-treated 96-well plates containing Xfect (Clontech)/DNA transfection complexes ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... media containing 0.1 μM rapamycin analog (Takara AP21967) or 0.1% ethanol as a control was added to cells ...
-
bioRxiv - Biochemistry 2021Quote: ... 10% glycerol) containing DNase I (10 U, Takara) and incubated at 37 °C for 1 hour ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 5X first-strand buffer (Clontech), DTT (20 mM) ...
-
bioRxiv - Microbiology 2019Quote: ... containing 10% Tetracycline-free fetal bovine serum complex (Clontech) and 1% penicillin-streptomycin (100 U penicillin/mL ...
-
bioRxiv - Immunology 2021Quote: ... the RT-RamDA mixture containing 2.5x PrimeScript Buffer (TAKARA), 0.6 μM oligo(dT)18 (Thermo) ...
-
bioRxiv - Plant Biology 2020Quote: ... Ade and His but containing X-α-gal (Clontech) and 10 mM 3-amino-1,2,4-triazole (3-AT) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2 μL of 5X SMARTScribe RT buffer (Takara), 0.5 μL of 100 mM DTT (Millipore Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... on agar plates containing indicated concentration of AureobasidinA (Clontech), Calcofluor White (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... a mixture containing 10μl 5x PrimeSTAR buffer (Takara, #R050B), 4μl dNTP (2.5mM ...
-
bioRxiv - Genetics 2019Quote: 3000 quiescent satellite cells were lysed after FACS by sorting directly into a 0.2ml tube containing 1 μl SMART-Seq Reaction Buffer (95% SMART-Seq 10x lysis buffer containing 5% SMART-Seq RNAse Inhibitor, Takara Bioscience, Cat. 634890) in 8μl ddH20 ...