Labshake search
Citations for Takara Bio :
1 - 50 of 1121 citations for Toscana Virus Glycoprotein 2 Gc Human Heterodimeric Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Microbiology 2021Quote: ... Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA, Mountain View, CA, USA) using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Genomics 2021Quote: ... 1×GC buffer ? (Takara, 9155) for 30 PCR cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Microbiology 2020Quote: ... SYBR Premix Ex Taq GC (TAKARA) was applied to run on StepOnePlus Real-time PCR System (Life Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus-containing media was harvested for virus isolation using Lenti-X concentrator (Takara) in lieu of ultracentrifugation ...
-
bioRxiv - Cell Biology 2019Quote: ... was amplified by TaKaRa LA TaqR with GC Buffer (TaKaRa, Japan). Primers were as following ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Retrovirus supernatant or medium containing virus particles was harvested at day 2 post transfection and concentrated by Retro-Concentrator (Clontech) solution ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Neuroscience 2023Quote: ... and the SYBR Premix Ex Taq GC (Takara Bio, Japan). Primers for qPCR (Supplementary Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Genomics 2022Quote: ... We used LA Taq with GC buffers (Cat# RR02AG, Takara Bio) or Multiplex PCR Plus Kit with Q-solution (Cat# 206152 ...
-
bioRxiv - Plant Biology 2021Quote: ... with the SYBR Green Premix EX Taq GC™ (Takara, Japan) according to the manufacture’s instruction with the primers shown in Supplementary Table S2-2 ...
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Cell Biology 2022Quote: ... The virus titer (ifu/ml) defined by Clontech’s Lenti-X qRT-PCR Titration Kit (Cat ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... Virus was precipitated using Lenti X-concentrator (Takara) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was conducted with TaKaRa LA Taq® with GC buffer (TaKaRa) as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-GFP-tag (Living Colors 632592; Clontech), anti-Strep-tag (34850 ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech). Lentivirus titers from 48h and 72h were determined by plaque assay (data not shown ...
-
bioRxiv - Immunology 2019Quote: ... and virus was concentrated using Lenti-X Concentrator (Takara). Existing mIRAK1mCherry and Irak1−/− iBMDM were then transduced with concentrated lentivirus ...
-
bioRxiv - Genomics 2021Quote: ... and virus was collected with LentiX Concentrator (Takara, # 631232). HUVEC were infected with combinations of two viruses and used 96 h after infection ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech), and suspended in PBS.
-
bioRxiv - Microbiology 2019Quote: ... Virus packaging was assessed using Lenti-X GoStix (Clontech) but virus titers were not otherwise measured ...