Labshake search
Citations for Takara Bio :
1 - 50 of 5226 citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa, Shiga, Japan), self-ligated by T4 ligase (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... T4 ligase and KOD PCR kit were purchased from Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Microbiology 2023Quote: ... T4 ligase (TaKaRa) was used to connect the digested PCR products and the vector at 16°C for 2 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ligations were performed using T4 DNA ligase (Fermentas) or InFusion HD kits (Clontech). Small-scale isolation of plasmid DNA was performed with Mini-Prep kits (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from seedlings and ligated to the 5’ RNA adaptor by T4 RNA ligase (TaKaRa). Reverse transcription was performed with 9-nt random primers and the cDNA amplified by PCR with an adaptor primer and a gene-specific primer ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... and T4 polynucleotide kinase (Takara). The extension reaction was performed with the AccuPower® DNA Sequencing Kit (Bioneer) ...
-
bioRxiv - Genetics 2020Quote: ... 1.5 μl T4 PNK (TaKaRa) and 3 μl RNase-free water up to a final volume of 75 μl ...
-
bioRxiv - Microbiology 2023Quote: ... ligated using T4 ligase (Takara) and transformed into chemically competent E ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... using T4 DNA ligase (Takara Bio). The ligation mixes were transformed into Stbl3 competent cells and the resultant clones were screened by checking the insert sizes and direct sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... phosphorylated by T4 polynucleotide kinase (TaKaRa) and inserted between SpeI and NotI restriction sites (pFastBac1-hCAP-D3-[3C]-StrepII ...
-
bioRxiv - Cell Biology 2022Quote: ... phosphorylated by T4 polynucleotide kinase (TaKaRa), and inserted between BamHI and EcoRI restriction sites by using restriction enzymes and a DNA ligation kit (TaKaRa) ...
-
bioRxiv - Zoology 2020Quote: ... and T4 DNA ligase (Takara, Japan) were applied for eukaryotic vector construction ...
-
bioRxiv - Microbiology 2019Quote: ... cyclized using T4 DNA ligase (Takara), and transfected into PK15 cells with the jetPRIME® in vitro transfection reagent (CPT114vJ Polyplus-transfection) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... together with phosphorylated (T4 polynucleotide kinase, Takara) primers that spanned the length of the RNA of the retrozyme (i.e. ...
-
bioRxiv - Plant Biology 2021Quote: ... by T4 DNA ligase (TaKaRa, Tokyo, Japan) for sequencing ...
-
bioRxiv - Genetics 2022Quote: ... Mighty Mix T4 DNA ligase from Takara; Dual luciferase reporter assay from Promega ...
-
bioRxiv - Plant Biology 2020Quote: ... With the T4 DNA ligase (TAKARA, 2011A), the product was ligated to the binary vector pCAMBIA1301-35SN ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Microbiology 2022Quote: ... then ligated with T4 DNA Ligase (Japanese Takara), and transformed into Escherichia coli BL21 ...
-
bioRxiv - Genomics 2022Quote: ... and T4 DNA polymerase (Cat# 2040, Takara Bio), ligated into pBluescript II KS(+) ...
-
bioRxiv - Genetics 2020Quote: ... self-ligated by T4 ligase (TaKaRa, Shiga, Japan), and then introduced into Escherichia coli DH5α competent cells (New England Biolabs ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...