Labshake search
Citations for Takara Bio :
1 - 50 of 72 citations for Tau Methyl L Histidine Methyl D3 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and histidine (-H) (TaKaRa 630319).
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech). Fractions by imidazole-elution were subjected to Hi-trap SP cation-exchange chromatography ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech). Fractions by imidazole-elution were subjected to Hi-trap SP cation-exchange chromatography ...
-
bioRxiv - Cell Biology 2019Quote: ... and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech). Fractions by imidazole-elution were subjected to Hi-trap SP cation-exchange chromatography ...
-
bioRxiv - Cell Biology 2019Quote: ... and purified with hexa-histidine affinity resin (Talon beads from Takara/Clontech). Fractions by imidazole-elution were subjected to Hi-trap SP cation-exchange chromatography ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio). pCI-SEP-NRI was a gift from Robert Malinow (Addgene plasmid # 23999 ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Microbiology 2020Quote: ... to remove cellular debris and the protein was column-purified using anti-histidine resin (ClonTech). The resin was washed ten times with 10x column volumes of wash buffer mixed with an increasing proportion of tris buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... Two-hybrid interaction was tested with YNB medium lacking histidine in Saccharomyces cerevisiae strain AH109 (Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... The expressed peptide was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Biochemistry 2022Quote: ... A398P and T435P mutations (pDONR221-AR-AD-TAU-5) using KOD polymerase (Takara Bio) and the following primer pair.
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... alone or also lacking adenine and histidine (SD-Trp/Leu/Ade/His/AbA) were performed following the manufacturer’s instructions (Clontech).
-
bioRxiv - Neuroscience 2023Quote: ... Tau was then purified batchwise from the supernatant using TALON Metal Affinity Resin (TaKaRa, 635502) according to the vendor’s instructions ...
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... membranes were incubated with epitope-specific rabbit polyclonal antisera or with an anti poly-histidine horseradish peroxidase-conjugated monoclonal antibody (TaKaRa). Immunodetection was revealed by using a Clarity Western ECL blotting substrate (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... and inserted between SpeI and NotI restriction sites (pFastBac1-hCAP-D3-[3C]-StrepII) by using restriction enzymes and a DNA ligation kit (TaKaRa). To create the hCAP-H2 construct with an N-terminal StrepII-tag (pFastBac-StrepII-[3C]-hCAP-H2) ...
-
bioRxiv - Genetics 2019Quote: BAC clone (BAC PAC RPCI- 98 library) DNA was extracted using a MIDI-prep kit (Clontech #740410). The probe for the bw locus was Clone BACR48M01 ...
-
bioRxiv - Biochemistry 2019Quote: ... A native poly-histidine region within the Spir-KIND domain is sufficient for binding of these constructs to TALON® resin (Clontech).
-
bioRxiv - Microbiology 2021Quote: For the generation of a tau-P301S expression plasmid the multiple cloning site (MCS) of the pLHCX vector (Clontech) was modified by inserting a synthetic MCS-sequence (ACCGGTCTCGAGGCGGCCGCGGCCAAAAAGGCCGGATCCGTTAACACCAAAAA ATGGCACGTGGCCGGCACGCGTGGGCCCGTCGAC ...
-
bioRxiv - Microbiology 2021Quote: ... SH-SY5Y cells constitutively expressing human tau 2N4R-P301S were generated by retroviral infection of pLHCX-mod-MCS-tau-P301S according to the manufacturer’s protocol (Clontech)
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Neuroscience 2019Quote: ... and doxycycline 2g/L (Clontech). On day 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Plant Biology 2024Quote: ... 0,77g/L SD-URA drop out mix (Clontech), 0.67 g/L Yeast Nitrogen Base (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2023Quote: ... pTIT-P and pTIT-L using Xfect Transfection Reagent (Takara, 631318) according to the instructions of the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... The clones growing in the –L/-T liquid selection medium (Clontech) were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech ...
-
bioRxiv - Plant Biology 2024Quote: ... and 10 μ L SYBR premium ExTaq Perfect Real Time (TaKaRa Bio), adjusted to a final volume of 20 μL with water ...
-
bioRxiv - Cancer Biology 2023Quote: ... Clarified lysate was mixed with ∼0.5 ml/L of culture cobalt resin (TaKaRa) for one hour ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Physiology 2019Quote: Cells were plated onto poly-L-lysine-coated coverslips and transfected using the Xfect (Clontech) transfection reagent ...
-
bioRxiv - Plant Biology 2024Quote: ... were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech) to determine interactions between the two proteins.
-
bioRxiv - Genetics 2021Quote: ... and were routinely cultured on gelatin-coated plates in t2i/L media: NDiff (N2B27) (Takara #y40002) supplemented with titrated 2i (0.2μM PD0325901 ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Microbiology 2024Quote: ... and L gene open reading frames (ORF) were amplified with PrimeSTAR® Max DNA Polymerase (TAKARA) and ligated between the NcoI and BamHI sites of the pTM1 vector with In-Fusion® Snap Assembly Master Mix (TAKARA ...
-
bioRxiv - Cancer Biology 2022Quote: ... gDNA from all cells were isolated using the Machery Nagel L Midi NucleoSpin Blood Kit (Clontech, 740954.20). Modifications to the manufacturer’s instructions were added as follows ...