Labshake search
Citations for Takara Bio :
1 - 50 of 2063 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Microbiology 2021Quote: ... Lenti-X 293 T cells (Takara Bio) grown in 10 cm dish were transiently transfected with the following plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gamma-retroviral transduction was facilitated by RetroNectin (#T100B, Takara Bio). Transduced and non-transduced (NT ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were transferred to retronectin-coated (Takara) plates previously spinoculated with retroviral particles at 2000ξg for 1.5h ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the AAVpro 293 T cell line (#632273, Takara) following the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... murine T cells were transferred to retronectin-coated (Takara) plates previously spinoculated with retroviral particles at 2000ξg for 1.5h ...
-
bioRxiv - Immunology 2022Quote: Transduction of T cells was performed with Retronectin (Takara) as previously described (22 ...
-
bioRxiv - Immunology 2023Quote: ... T cells were transduced by centrifugation on Retronectin (Takara)-coated plates.
-
bioRxiv - Molecular Biology 2022Quote: Clontech SMARTer Polymerase Chain Reaction kit (Takara) was used to produce compatible polyA-transcript cDNA ...
-
bioRxiv - Cell Biology 2021Quote: Human embryonic kidney 293 T cells (HEK293T, Takara, Cat# 632180) were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... Samples showing the correct size band for heavy and light chain amplification in the respective wells were subsequently cloned into pAb20-hCHIgG1 (Synbio; for heavy chain) and pAb20-hCK (Synbio; for light chains) through in-fusion cloning (Takara). The ligated product was transformed to DH5-α competent cells ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Cancer Biology 2019Quote: ... then subcloned into T-clone vector pMD19-T (TaKaRa) to generate pT-DMP-2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... then subcloned into T-clone vector pMD19-T (TaKaRa) to generate pT-DMP-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK-293 T cells were transfected with calcium phosphate (CalPhos, Clontech) in T75 flasks using 30 μg of plasmid DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the total extracted RNA was reverse-transcribed into cDNA for polymerase chain reaction amplification using the real-time polymerase chain reaction SYBR Green kit (TaKaRa, Guangzhou, China). The reverse transcription steps were as follows ...
-
bioRxiv - Microbiology 2023Quote: Polymerase chain reaction (PCR) was conducted using ExTaq (TaKaRa) to amplify the SLST locus ...
-
bioRxiv - Molecular Biology 2024Quote: ... Polymerase chain reactions were performed using PrimeSTAR Max (Takara). Synthetic genes for mGreenLantern and mLychee were ordered from Integrated DNA Technologies.
-
bioRxiv - Immunology 2023Quote: Effector cells (NK92, T cells, and NK cells) were transduced with retroviral supernatants by centrifugation on RetroNectin (Takara) coated plates ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: Using the Lenti-X 293 T cell line (Takara Bio Inc., Otsu, Japan) and the pLVSIN-EF1α-AcGFP-C1 vector ...
-
bioRxiv - Microbiology 2021Quote: ... were transduced into TCR-deficient Jurkat cells or primary T-cells using the Plate-GP and PG13 cell-based retrovirus system and Retronectin (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Dynabeads were removed and stimulated T cells were seeded on Retronectin (Takara Bio, Japan) coated nontissue culture treated plate with virus ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral transduction of primary T cells was performed with retronectin-coated plates (Takara Bioscience). Naïve T cells had been activated as described in ‘Cell Cultures’ methods for two days before transduction ...
-
bioRxiv - Immunology 2020Quote: mRNA was extracted from the CD8+ T cells using the TRIzol agents (TAKARA, Japan). mRNA expression was quantified in qRT-PCR using the TB Green® Premix Ex Taq™ II (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... A polymerase chain reaction (PCR) master mix containing ExTaq DNA polymerase (Clontech), ExTaq buffer (Clontech) ...
-
bioRxiv - Cell Biology 2021Quote: ... A polymerase chain reaction (PCR) master mix containing ExTaq DNA polymerase (Clontech), ExTaq buffer (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X 293 T (Clontech), Neuro2A (mouse neuroblastoma ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Cell Biology 2019Quote: ... in the T/C-28a2 chondrocyte cell after transfection with a pIRESpuro2 plasmid construct (Clontech) containing the human Cx43 sequence ...
-
bioRxiv - Immunology 2022Quote: Gammaretroviral transduction of γδ T cells was carried out in RetroNectin (Takara Bio, Tokyo, Japan)–coated 24-well plates ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Zoology 2019Quote: ... Polymerase chain reactions (PCRs) were performed using Tks Gflex™ DNA Polymerase (Takara) and conducted in a T100™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reaction (PCR) fragments were generated using PrimeSTAR Max DNA Polymerase (TaKaRa). The method for plasmid construction is described below.
-
bioRxiv - Bioengineering 2021Quote: Polymerase Chain Reactions (PCR) were conducted using PrimeSTAR GXL DNA Polymerase (Takara Bio) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed using PrimeSTAR GXL DNA Polymerase (TaKaRa, R050A), following the recommended Rapid PCR protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Polymerase chain reaction (PCR) was performed using Primer STAR Max DNA Polymerase (Takara) to amplify the target gene ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Immunology 2020Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Immunology 2020Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Immunology 2022Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Immunology 2022Quote: ... Virus titer was determined by using Jurkat T cells and Lenti-X GoStix Plus (Takara Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... and oligo(T)18 primers (Takara). Relative transcript amounts were measured by SYBR-green quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... and cloned into pMD18-T (Takara) vector and then transformed into E.coli DH5α for sequencing ...
-
ARL3 Mediates BBSome Ciliary Turnover by Promoting Its Outward Diffusion through the Transition ZonebioRxiv - Cell Biology 2021Quote: ... and oligo(T)18 primers (Takara). ARL3 cDNA and cDNAs encoding the six BBS proteins BBS1 ...
-
bioRxiv - Microbiology 2021Quote: ... and inserted to pMD19-T (TAKARA) to obtain pMD19-T-MMP0852/0853 (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... and inserted to pMD19-T (TAKARA) to obtain pMD19-T-Pmcr-tetR-Tmcr (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the amplified PCR products were cloned into a T/A cloning vector PMD18-T (TaKaRa, Tokyo, Japan), and later excised from PMD18-T plasmid using NotI and XhoI restriction sites ...