Labshake search
Citations for Takara Bio :
1 - 50 of 4951 citations for SpectraDye Antibody Labeling Kit IR700 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... prepared using a random primer labeling kit (Takara)79.
-
bioRxiv - Molecular Biology 2024Quote: ... using a random primer DNA labeling kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Random Primer DNA Labeling Kit (TaKaRa, 6045) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... or IMPA1L 120nt fragment were labeled using Random Priming Labeling Kits (Takara or Roche) and [α−32P] dCTP ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Plant Biology 2023Quote: ... and then probes for siRNA detection were made using the BcaBEST Labeling Kit (Takara Bio) with [α-32P]dCTP (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2020Quote: Labeling of T7 RNA polymerase (Takara bio) was performed using Alexa Fluor™ 647 Protein Labeling kit (Thermo scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection relied on a 32P-labeled DNA probe specific for GFP sequence synthesized with a random priming labeling kit (Takara) followed by exposure to film and development as described (43).
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 0.04% Bovine Serum Albumin and prepared for single-cell separation and labeling using the iCELL8 Single-Cell System (Wafergen, Takara Bio) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... The rituximab and cetuximab antibody variable sequences were generated by IDT and cloned into the variable regions of the VRC01 antibody plasmid vector (a generous gift from the Kim lab at Stanford) by using the In-Fusion cloning kit (Takara) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2023Quote: ... The tissue was fixed for 30 min and the immunoprecipitation performed using a SEP3-specific antibody followed by library preparation using ThruPLEX DNA-Seq Kit (Takara) and deep sequencing65 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GAPDH antibody (Clontech) at a 1/2500 dilution ...
-
bioRxiv - Genetics 2019Quote: ... Antibodies used were GAL4 AD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630402), GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubation with the primary antibody (polyclonal rabbit anti-dsRed antibody, 632496, Clontech, dilution 1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... SMAD2 #3122 and SMAD3 #9523 antibodies (Cell Signalling Technology) and anti-FLAG antibody (Clontech). Horseradish peroxidase-conjugated secondary antibodies and anti-rabbit and anti-mouse antibodies were acquired from Molecular Probes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The following antibodies were used: Anti-GFP antibody (JL-8 from Takara, Shiga, Japan), anti-Flag antibody (M2 from Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Cell Biology 2021Quote: ... 1982) or a commercial antibody against dsRed that detects mCherry (Living Colors DsRed Polyclonal Antibody, Clontech). After 3 consecutive 5-min washes in PBS ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... combined with TaqStart Antibody (639250, Takara Bio Europe ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.22 µg TaqStart Antibody (Clontech). 45-50 cycles of amplification were performed on a Bio-Rad C1000 thermocycler and the resulting product visualized with ethidium bromide on a 2% agarose gel.
-
bioRxiv - Plant Biology 2022Quote: ... The anti-GFP antibody (TaKaRa, 632381), the anti-LhcB2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti GFP antibody (Clontech, lot. 1404005) and anti-H3 (Abcam ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Immunology 2022Quote: ... Seq Kit (Takara), as per the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA was retro-transcribed by Takara kit (Takara Bio), GAPDH was used as internal reference ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... In-fusion HD kit and In-Fusion Snap Assembly kit (TaKaRa). pRSETa_mEos4b was a gift from Loren Looger (Addgene plasmid #51073 ...
-
bioRxiv - Cancer Biology 2023Quote: ... LipofectamineTM 2000 kit and reverse transcription kit were purchased from TaKaRa Company ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...