Labshake search
Citations for Takara Bio :
1 - 50 of 845 citations for Siglec 2 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Molecular Biology 2021Quote: TET-ON stable HEK293 cells with the Tetracycline-inducible expression constructs were grown in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 400 ng/ml Doxycycline (SIGMA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Tet-off cells (Clontech) were transfected with pTRE-TIGHT plasmids bearing the (de)optimized and WT sequences and incubated overnight at 37ºC ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293 Tet-ON cells (Clontech) were co-transfected with linearized pTRE-HTT128Q together with a plasmid expressing a hygromycin resistance gene ...
-
bioRxiv - Neuroscience 2020Quote: We transiently co-transfected cDNA constructs of GluN1 and GluN2A into mammalian human embryonic kidney 293 (HEK293) with a separate pEGFP-Cl vector (Clontech) at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP ...
-
bioRxiv - Cell Biology 2020Quote: ... 7.5 × 107 Hek293-lentiX cells (Clontech) were seeded on 15-cm tissue culture plates ...
-
bioRxiv - Cancer Biology 2019Quote: HEK293 Lenti-X (Clontech, Cat. # 632180) cells were cultured in DMEM with 10% FBS ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (Clontech #C3003-1; lot #7030396) cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells (DMSZ) and HEK293T cells (Takara) were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2019Quote: ... HEK293 cells were transfected using Xfect (TakaRa, #631318) with the viral packaging construct [pMDLg/pRRE (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... Lenti-X HEK293 cells (Takara Bio, Cat #632180) were transfected with pHR-SFFV-dCas9-BFP-KRAB ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Cancer Biology 2019Quote: ... embryonic kidney cell line HEK293(ATCC CRL-1573) and 293GP cells (Clontech) were cultured in high glucose (5g/l ...
-
bioRxiv - Immunology 2023Quote: ... CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were co-transfected either with pEGFP-N1 (Clontech, 6085-1) or pCAG-DsRed-T1 (gift from Prof ...
-
bioRxiv - Cell Biology 2020Quote: ... foetal bovine serum or 10% (v/v) TET System–approved FCS for U–2–OS reporter cell lines (631106, Takara Bio). U–2–OS-pEP15 cells (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Cell Biology 2021Quote: ... The HEK293-based Lenti-X 293T (HEK293T) cell line was obtained from Takara Bio (Shiga ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2022Quote: ... Virus containing supernatants were harvested five times from transfected Ecopack-HEK293 cells (Clontech/Takara), over a period of three days post-transfection and filtered with 0.45 µm filters ...
-
bioRxiv - Cell Biology 2022Quote: ... Virus containing supernatants were harvested five times from transfected Ecopack-HEK293 cells (Clontech/Takara), over a period of three days post-transfection and filtered with 0.45 µm filters ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... HEK293T and CHO-K1 cell lines were ordered from American Type Culture Collection (ATCC) and HEK293-tetON cells and CHO-tetON cells were purchased form Clontech (Takara Bio). Synthetic DNA was ordered from Twist Bioscience.
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses containing guide RNAs targeting GORAB were created in HEK293 Lenti-X cells (Takara 31966021) plated on 10 cm dishes the day before transfection ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells (JRCB Cell Bank, Osaka, Japan) and AAVpro 293T cells (Takara Bio Inc., Shiga, Japan) were cultured in Dulbecco’s modified Eagle Medium (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... the CPER products were transfected into HEK293-hACE2/hTMPRSS2 cells by using TransIT-LT1 (Takara, Cat# MIR2305). At one day post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were transfected with pX330 vector together with an EGFP-containing plasmid (pEGFP-N1; Clontech Laboratories, Inc). Single cells were sorted using a FACS Vantage SE machine and the knockouts confirmed by sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... The transfection efficiency of HEK293 cells was evaluated by transfecting cells with EGFP-N1 (Clontech; Mountain View, CA) in parallel reactions ...
-
bioRxiv - Neuroscience 2022Quote: All viruses were made using the 2nd generation lentiviral packaging systems in Lenti-X HEK293 FTT cells (Takara). Lenti-X cells were passaged maximum 3 times before being used for virus production in HEK media (High glucose DMEM with 4 mM GlutaMAX ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 10% tetracycline-free fetal calf serum (FCS) (TaKaRa Bio, 631106), 2 mM L-Glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were first incubated with ARIAD ligand at a concentration of 1 µM (AL; D/D Solubilizer; Takara) for the indicated times ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Neuroscience 2022Quote: AAVs were packaged via calcium phosphate transfection of HEK293 cells as detailed in (McClure et al 2011) and purified using an AAVpro purification kit (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP 61,62 (400ng) using TransIT-LT1 (Takara, Cat# MIR2306). On day 3 (24 hours post transfection) ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2021Quote: The cDNA encoding human BORCS6 was cloned from human lung total RNA (Takara Bio, Japan) and inserted into pCR4-TOPO (Invitrogen ...