Labshake search
Citations for Takara Bio :
1 - 50 of 414 citations for SLAM Family Member 8 SLAMF8 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-GFP monoclonal antibody JL-8 (632381, Clontech) was used at 1/3000 ...
-
bioRxiv - Microbiology 2023Quote: ... GFP tag (JL-8 monoclonal antibody from Takara), and mCherry (polyclonal antibody from Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The following antibodies were used: Anti-GFP antibody (JL-8 from Takara, Shiga, Japan), anti-Flag antibody (M2 from Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-HY5 (Oravecz et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Neuroscience 2021Quote: ... Monoclonal GFP antibodies (clone JL-8; lot# A5033481-A) were from Clontech Takara Bio (San Jose ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Plant Biology 2022Quote: ... Blots were probed with anti-GFP monoclonal antibody JL-8 (632381, Clontech) diluted at 1/3000 in 1X PBS containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Microbiology 2020Quote: ... Western blotting was performed using standard procedures with the following primary antibodies: JL-8 monoclonal antibody (Takara) for GFP variants ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... sf-GFP-Sps1 was detected using JL-8 anti-GFP antibodies (Takara/Clontech) at 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... sf-GFP-Sps1 was detected using JL-8 anti-GFP antibodies (Takara/Clontech) at 1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies used for this study were: mouse anti-GFP JL-8 (Clontech, 1:3000), rabbit anti-PfEF1α (from D ...
-
bioRxiv - Biochemistry 2021Quote: ... monoclonal antibody for green fluorescent protein (JL-8; Takara Bio, Kusatsu, Japan; recognizes VC), rabbit anti-GFP (D5.1 Cell Signaling Technology 2956S ...
-
Kinetic analysis reveals the rates and mechanisms of protein aggregation in a multicellular organismbioRxiv - Biophysics 2020Quote: ... and the Western blots were probed with JL-8 anti-GFP antibody (Takara Bio) and scanned on an Azure c600 (Azure Biosystems) ...
-
bioRxiv - Plant Biology 2020Quote: ... mTurq2cp was immunodetected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti-mouse-HRP (1:15000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-Mob1 and variants were detected using an anti-GFP antibody (Clontech, JL-8) at a 1:1000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech, dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: mouse anti-GFP JL-8 (1:1000; TaKaRa), mouse anti-Tubulin AA4.3-c (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were probed with commercial mouse monoclonal antibodies: anti-GFP (Clontech Living Colors JL-8), anti-mCherry (Abcam 1C51 ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of PHOT1-citrine was done using Living Colors anti-GFP antibody JL-8 (632381, Clontech), 1:4000 in PBS 5% milk 0,1% tween (PBSTM) ...
-
bioRxiv - Developmental Biology 2022Quote: Primary antibodies and concentrations used: mouse anti-GFP Living Colors (JL-8) (Takara Biosciences; cat# 632381) 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study were as follows: mouse anti-GFP (JL-8, dilution 1:1000) (Clontech); Alexa 488- ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP (JL-8, Clontech) or Vinculin (7F9 ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Bioengineering 2024Quote: ... GFP was detected with a monoclonal mouse anti-GFP antibody (JL-8, Takara Bio USA, San Jose, CA) in Western blot analyses.
-
bioRxiv - Cell Biology 2022Quote: ... GFP (JL-8, Clontech, #632381). Secondary antibodies used included ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP (632381,JL-8, Takara), p-VASP (3111 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl Cloning Enhancer (Takara) was added to 20 µl of the PCR product and incubated for 15 min at 37 °C on a thermocycler ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...