Labshake search
Citations for Takara Bio :
1 - 50 of 391 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Systems Biology 2023Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Table S1 for full descriptions of constructs.
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 Spike sequence was cloned into the linearized pVSV-eGFP-dG by the In-Fusion cloning system (Takara Bio Inc.). The resulting pVSV-eGFP-deltaG_SARS-CoV-2 Spike vector was verified by sanger sequencing ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Plant Biology 2023Quote: ... under the control of cauliflower mosaic virus 35S promoter in the binary vector pBI121 (Clontech, USA) was transferred into Agrobacterium tumefaciens strain GV3101 and used to transform Arabidopsis by floral dip method and tobacco plants by leaf disk method (Horsch et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... digested spike backbone vectors (Takara).
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Microbiology 2020Quote: ... coli (Clontech), extracted and retransformed into EAW19 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Plant Biology 2021Quote: The Pro197Ser-mutated ALS genes and the native form of MvALS1 gene were inserted into the pCAMBIA1390 vector under the cauliflower mosaic virus 35S promoter using the In-Fusion DH Cloning Kit (TaKaRa), as described previously (Iwakami et al. ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Plant Biology 2020Quote: ... plant intron Syn7 [34] regulated by a double-enhancer Cauliflower mosaic virus 35S RNA promoter (P35S2) and a nos terminator in the T-DNA binary vector pBI121 (Clontech, Switzerland). Syn7 was amplified with the primers 5′- GAGCTGAAAGggtaagattatcgatatttaaattatttatttcttcttttc-3′ and 5′-TGAAGTCGATGCctgcatgatatcataaaaccatgga-3′ specifying the splicing junctions and then inserted into the YFP coding region by overlapping PCR ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Takara) and selected on LB-Ampicillin plates ...
-
bioRxiv - Biochemistry 2020Quote: ... coli cells (TaKaRa) were transformed with these plasmids for amplification and DNA storage ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) or Stellar™ (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Clontech 636763) via heat shock ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... coli (Takara,#9027) were transformed using electroporation and the subcloned library was obtained by combining 4 maxipreps ...
-
bioRxiv - Microbiology 2021Quote: ... coli DH5α (Takara) and Stellar™ (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar (Takara) and E ...
-
bioRxiv - Cell Biology 2022Quote: ... coli (Takara Bio). Plasmids were purified by miniprep (Qiagen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli Stellar (Takara) cells on LB- or M9 minimal-agar supplemented with 1 mM IPTG were inoculated into 250 μL of the same liquid medium and grown in a 1.5-mL 96-deep well plate at 240 rpm for ~10 generations ...
-
bioRxiv - Genomics 2023Quote: ... coli (Takara Bioscience). 1% of the transformed cells were plated on ampicillin-agar plates to ensure adequate transformation efficiency (at least 10-fold library coverage) ...
-
bioRxiv - Genomics 2023Quote: ... coli (Takara, 636763) and 10 colonies were picked at random to ensure that each colony was unique ...
-
bioRxiv - Biochemistry 2020Quote: ... full-length (1-1143) or C-term (620-1143) was inserted into pGBKT7 (Clontech, Mountain View, CA) using SmaI/SalI restrictions sites ...
-
bioRxiv - Microbiology 2022Quote: ... genomic DNA was digested with S1 nuclease (TaKaRa, Kusatsu, Japan) at 37°C for 20 minutes ...
-
bioRxiv - Immunology 2021Quote: pVAX1-SARS-CoV2-co was designed by Takara, which encoded a highly optimized DNA sequence encoding the SARS-CoV-2 Spike glycoprotein ...
-
bioRxiv - Physiology 2020Quote: ... coli Stellar cells (Clontech/Takara Bio USA Inc. ...
-
bioRxiv - Bioengineering 2019Quote: ... coli BL21 (DE3) (TaKaRa, hsdS ...
-
bioRxiv - Biophysics 2020Quote: ... coli (TOYOBO or TaKaRa), calf intestine (Roche) ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells (Stellar, TaKaRa) were used for all cloning steps and were grown in LB medium supplemented with antibiotics as required - ampicillin (100 μg/mL) ...
-
bioRxiv - Microbiology 2021Quote: ... coli Stellar™ (Takara) following standard protocols [56] ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain StellarTM (ClonTech), prior to isolation and transformation into COH1 GBS ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa), grown in LB medium at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa). A synthetic version of the E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Takara Bio) and positive clones were identified via RFP selection before sequencing to confirm the cloning was successful.
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar cells (Takara) for non-R6K origin of replication-based vectors or PIR2 cells (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... coli HST08 (Takara Bio). The pLI50_pgl plasmid was then isolated and transformed by electroporation into the restriction-deficient strain RN4220 ...
-
bioRxiv - Genomics 2022Quote: ... coli cells (Takara Bio) and plasmid was prepared following standard protocols ...
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar (Takara Bio) cells and plated on selective Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2023Quote: ... coli StellarTM (Takara Biosciences) was used for cloning and plasmid storage ...
-
bioRxiv - Developmental Biology 2023Quote: ... coli (Takara Bio, 636763) via ampicillin-resistant selection ...
-
bioRxiv - Genomics 2023Quote: ... coli cells (Takara Bioscience). Sanger sequencing (Genewiz ...