Labshake search
Citations for Takara Bio :
1 - 50 of 714 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 Horseradish Peroxidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 Spike sequence was cloned into the linearized pVSV-eGFP-dG by the In-Fusion cloning system (Takara Bio Inc.). The resulting pVSV-eGFP-deltaG_SARS-CoV-2 Spike vector was verified by sanger sequencing ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Immunology 2021Quote: ... The RNA of the SARS-CoV-2 was extracted for reverse transcription (TAKARA, Japan). The SARS-CoV-2 was quantitative analyzed with real time PCR by targeting S protein.
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... covering the full-length SARS-CoV- 2 genome were amplified by PCR using a PrimeSTAR GXL DNA polymerase (TaKaRa Bio), the synthesized cDNA and specific primer sets from CoV-2-G1-Fw to CoV-2-G10-Rv designed previously (21) ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio). pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... nine DNA fragments encoding the partial genome of SARS-CoV-2 (hCoV-19/Japan/TY-WK-521/2020) were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A). A linker fragment encoding the hepatitis delta virus ribozyme ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2021Quote: TET-ON stable HEK293 cells with the Tetracycline-inducible expression constructs were grown in DMEM supplemented with 10% TET-approved FCS (Clontech) and induction of expression of respective gene product was carried out for indicated time durations using 400 ng/ml Doxycycline (SIGMA) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently stained using a horseradish peroxidase (HRP)-conjugated monoclonal anti-StrepTag antibody (Iba) or mouse anti-6His (Clontech) monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO) ...
-
LptM promotes oxidative maturation of the lipopolysaccharide translocon by substrate binding mimicrybioRxiv - Microbiology 2023Quote: ... membranes were incubated with epitope-specific rabbit polyclonal antisera or with an anti poly-histidine horseradish peroxidase-conjugated monoclonal antibody (TaKaRa). Immunodetection was revealed by using a Clarity Western ECL blotting substrate (BioRad ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Tet-off cells (Clontech) were transfected with pTRE-TIGHT plasmids bearing the (de)optimized and WT sequences and incubated overnight at 37ºC ...