Labshake search
Citations for Takara Bio :
1 - 50 of 374 citations for Retinol Binding Protein RBP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio). Plasmids were transformed into AH109 strain as described previously (Gietz and Woods ...
-
bioRxiv - Plant Biology 2020Quote: ... and Lamin (LAM) were cloned into the DNA-binding domain vector pGBKT7 (Clontech Matchmaker System). The full-length open reading frame of NAA50 ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Genetics 2021Quote: The coding sequence of the MAR was inserted into the Gal4 DNA-binding domain vector pGBKT7 (Clontech); the coding sequences for full length Nup60 and Nup60(188-388 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mixed with 50 μL TALON Co2+ resin pre-equilibrated in binding buffer A (Takara Bio, 50% slurry) resulting in a final volume of 100 μL ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Plant Biology 2024Quote: ... the full-length ORF of PpGL2 fused with the GAL4 DNA binding domain in the PGBKT7 vector (Clontech, Japan) was transformed into the competent yeast strain Y2HGold ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified using the corresponding primers (Supplementary Table S3) and fused with the DNA-binding or activation domain of GAL4 in the corresponding pGBT9 and pGAD424 vectors (Clontech). Details of assembling the constructs for expressing proteins in transgenic flies are available upon request.
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Microbiology 2021Quote: ... yeast containing the Gal4 activation domain-based prey and the Gal4 DNA-binding domain-based bait vectors were grown overnight in SD-Leu-Trp broth (Clontech). The OD600 value was recorded ...
-
bioRxiv - Cell Biology 2020Quote: ... Point mutants of the microtubule-binding domain were created using site-directed mutagenesis using PrimeSTAR Max DNA polymerase (Takara Bio).
-
bioRxiv - Plant Biology 2022Quote: ... fragments were recombined into GW versions of the GAL4 DNA-binding domain vector pGBT-9 and the activation domain vector pGAD424 (Clontech). Oligonucleotides used for cloning are listed in Supplementary Table S3.
-
bioRxiv - Plant Biology 2022Quote: ... The CWLP coding region without signal peptide (SP) was cloned in frame downstream of the GAL4 DNA-binding domain in the bait vector pGBKT7 (Clontech) and introduced into the yeast strain AH109 (Clontech) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... where the entire ORF of the corresponding gene was inserted in frame into the pGADT7 (GAL4 activation domain) or pGBKT7 (GAL4 binding domain) plasmid (Clontech).
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Biochemistry 2019Quote: ... A native poly-histidine region within the Spir-KIND domain is sufficient for binding of these constructs to TALON® resin (Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Immunology 2021Quote: ... The TSO was designed with two isodeoxynucleotides at the 5’ end to prevent TSO concatemerization and three riboguanosines at the 3’ end for increased binding affinity to the appended deoxycytidines (property of the Takara reverse transcriptase) (56 ...
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... bait proteins were cloned into the pGBKT7 vector which encodes the GAL4 DNA binding domain and then transformed into the Y2H Gold strain (Clontech, Mountain View, California) and plated on SD/- Trp to select for positive transformants ...