Labshake search
Citations for Takara Bio :
1 - 50 of 662 citations for Recombinant Mouse Shh His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged mCherry (mCherry-His) was PCR amplified from pmCherry-C1 vector (Takara) templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara) ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilized metal affinity chromatography (IMAC using Talon resin; Takara Bio). The buffer used during the purification process was 20 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Biochemistry 2019Quote: ... a 96-well Capturem His-tagged purification kit (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged CD45RO was purified by TALON affinity resin (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Neuroscience 2021Quote: ... His-tagged Cbln1 were purified by Talon metal affinity resin (Clontech) and dialyzed against HBSS ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Capturem™ His-Tagged Purification Maxiprep Kit (Takara). The binding reaction was performed in 20 μL binding buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Biophysics 2021Quote: ... His-tagged QUEEN protein was bound to TALON Metal Affinity Resins (Clontech) at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tagged proteins were purified with His60 Ni Superflow resin (TaKaRa; 635677) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The protein library was purified using a His-Tagged 96-well plate cartridge (Clontech) and buffer exchanged into 50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Pathology 2020Quote: ... RBD-scFv was purified from the supernatant using Capturem™ His-Tagged Purification Miniprep Kit (Takara Bio). One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA3.4 expression vector containing the sequence that encodes the His-tagged extracellular domain of the spike protein was transfected into Expi293 cells and the His-tagged spike protein produced in the culture supernatants was then purified with a Talon resin (Clontech).
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... His-tagged AmiC was isolated from the protein sample using a TALON® metal affinity resin (Takara Bio USA, Inc) as previously described (51 ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... GFP-tagged full-length mouse Creb3l3 cDNA was inserted into pEGFP (GFP-CREB3L3) (Clontech), mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c ...
-
bioRxiv - Molecular Biology 2023Quote: ... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2019Quote: Expression plasmid for mouse FLAG tagged BAG3 (pFLAG-BAG3) was constructed by cloning partial mouse BAG3 cDNA containing the whole CDS into pEGFP-N1 (Clontech). Forward primer sequence used to clone BAG3 plasmid is 5′-AAAGGATCCAGCGCCGCCACCC-3′ and the reverse primer sequence is 5′-GACTCTAGATCACTAGGGAGCCACCAGGTTGC-3′ ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-026 was generated by subcloning a DNA fragment encoding an N-terminus FLAG-tagged mouse eIF2α coding sequence flanked by BamHI and EcoRI sites into the BglII and EcoRI sites of pLPCX (Clontech) using standard molecular biology methods ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of GFP- or Venus-tagged constructs was measured by Western blot with mouse anti-GFP antibody (Clontech; 1:2,000). The expression of WT and mutant arrestin-3 was measured with rabbit polyclonal anti-arrestin-3 antibody ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Bioengineering 2019Quote: ... MO). The horseradish peroxidase (HRP)-conjugated monoclonal anti-His antibody (anti-mouse Cat. #631210) was obtained from Clontech (Mountain View, CA). The ultrasensitive HRP substrate used for Western blotting was from TaKaRa (Shiga ...