Labshake search
Citations for Takara Bio :
1 - 50 of 750 citations for Recombinant Mouse SHH Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant protein was produced in Escherichia coli BL21 (DE3) and purified with TALON resin (Clontech). For immunization ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... After 12 h medium was collected and recombinant proteins were purified on TALON metal affinity resin (Takara). 200 μl of the resin was loaded onto 1 ml column (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant RNase inhibitor (Takara) and protease inhibitor cocktail (Sigma-Aldrich)) ...
-
bioRxiv - Systems Biology 2023Quote: ... Recombinant DNase I (TaKaRa) was used to digest DNAs ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Microbiology 2019Quote: ... The Pfc43opt recombinant protein was soluble and purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant protein in the soluble fraction was then purified using TALON Metal Affinity Resin (Clontech Laboratories, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... 1.85U recombinant RNase Inhibitor (Takara), 1.85 μM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
bioRxiv - Plant Biology 2019Quote: 6His-GST-CRK2cyto and 6His-MBP-RBOHD/C constructs for recombinant proteins were generated by using In-Fusion technology (Clontech). The coding regions of CRK2cyto (WT ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The recombinant proteins were purified using a TALON Metal (Cobalt) Affinity Resin column (Clontech Laboratories, Inc., Palo Alto, CA, USA) and eluted with a linear gradient of imidazole (0–1,000 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilized metal affinity chromatography (IMAC using Talon resin; Takara Bio). The buffer used during the purification process was 20 mM Tris-HCl ...
-
bioRxiv - Immunology 2021Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... and Recombinant RNAse i nhibitor (TaKaRa). cDNA was prepared from total RNAs using ReverTra Ace (TOYOBO) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Recombinant RNase Inhibitor (Takara, Japan) were added into the cell pellets ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.85 U recombinant RNase Inhibitor (Takara), 1.85 µM template-switching oligo was aliquoted to each lysed cell using a Nanodrop II liquid handling system (BioNex ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Plant Biology 2019Quote: ... and 6His–MBP–CALS1_N (CALS1 N-terminus) recombinant proteins were generated using In-Fusion technology (Clontech; Takara Bio USA, Mountain View, USA). The fragment of CRK2cyto (WT ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant proteins were extracted from this crude lysate by affinity purification with TALON Affinity Resin (Takara Bio USA, Mountain View, CA, USA), washed with a solution containing 50 mM sodium phosphate ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein in the soluble fraction was then purified using TALON® Metal Affinity Resin (Clontech Laboratories, Mountain View, CA, USA) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Microbiology 2020Quote: ... 160 μl recombinant RNase inhibitor (Takara Clonetech), 1.6 ml of 10 mM dNTP (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2020Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was purified with an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... 160 µL recombinant RNase inhibitor (Takara Clonetech), 1.6 mL of 10 mM dNTP (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1ul recombinant RNase inhibitor (Takara, 2313B) incubated on ice for 5min ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.2U/ml Recombinant ribonuclease inhibitor (Takara, #2313B). A second centrifugation (same conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 5U of Recombinant RNAse inhibitors (Takara), and then were washed in 1x PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with recombinant DNase I (Takara). The treated RNA was subsequently purified using an RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.025 μL recombinant RNase inhibitor (Takara, 2313B), 0.04 μL reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.02 μL recombinant RNase inhibitor (Takara, 2313B) and 2.21 μL nuclease-free water per reaction (Thermo Fisher Scientific ...