Labshake search
Citations for Takara Bio :
1 - 50 of 111 citations for Rcombinant Cynomolgus PDCD1LG2 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and cynomolgus monkey were cloned into a pLVSIN-CMV Hyg vector (TaKaRa, Cat# 6182) predigested with NotI-HF (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... supplemented with 12% FCS (Clontech), 100 U/ml penicillin (Invitrogen) ...
-
bioRxiv - Biochemistry 2019Quote: ... a 96-well Capturem His-tagged purification kit (Clontech) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... EGFP tagged construct was generated in pEGFP-N1 (Clontech).
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% tetracycline-free FCS (Clontech/TaKaRa, #631106), 2 mM L-Glu ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-tagged human β-actin (Clontech, Mountain View, CA, USA) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... sfGFP-tagged proteins were visualized with monoclonal anti-GFP (Takara). Anti-Sty1 polyclonal antibody (Jara et al ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged CD45RO was purified by TALON affinity resin (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... His-tagged Cbln1 were purified by Talon metal affinity resin (Clontech) and dialyzed against HBSS ...
-
bioRxiv - Neuroscience 2023Quote: Human MAP2C cDNA tagged with 6xHis was inserted into pAcGFP (Takara) vector using In- Fusion cloning kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... His6-tagged proteins were purified with Talon metal affinity resin (Clontech) using the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Capturem™ His-Tagged Purification Maxiprep Kit (Takara). The binding reaction was performed in 20 μL binding buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... GST-tagged protein was eluted with 6ml glutathione (10mg/ml, Takara) and the flow-through was collected ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Biophysics 2021Quote: ... His-tagged QUEEN protein was bound to TALON Metal Affinity Resins (Clontech) at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tagged proteins were purified with His60 Ni Superflow resin (TaKaRa; 635677) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis tagged proteins were purified using Talon Co2+ affinity resin (Takara Bio, USA) and eluted with 150 mM Imidazole in the lysis buffer pH 7.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-tagged PDE5A isoforms plasmids [19] were co-transfected with pDsRed-mito (Clontech) into HEK293 cells using Lipofectamine 3000 (Life Technologies ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged mCherry (mCherry-His) was PCR amplified from pmCherry-C1 vector (Takara) templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: Hexa-Histidine (6×His)-tagged bacterial expression constructs were created using pColdI (Takara) vector backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST-tagged protein or on TALON-Cobalt beads column (635507, Takara Bio) for 6XHIS-tagged protein as previously described [19,26] ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Biochemistry 2022Quote: ... NUT3 and NUT4 and RFP tagged p300 were cloned into pEGFP-C1 vector (Clontech), HA-tagged p300 constructs (WT ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... GFP-tagged full-length mouse Creb3l3 cDNA was inserted into pEGFP (GFP-CREB3L3) (Clontech), mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The protein library was purified using a His-Tagged 96-well plate cartridge (Clontech) and buffer exchanged into 50 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP-tagged proteins were detected using the anti-GFP antibody (JL-8, Clontech Takara) diluted 1:2000 (v/v ...
-
bioRxiv - Neuroscience 2019Quote: Syt1-Myc-tagged lentiviral constructs were generated using the pCMV-Myc-N vector (Clontech) containing full-length rat Syt1 and a preprotachykinin signal sequence cloned upstream of the Myc tag as described in ref.17 The F349A mutation was introduced using site directed mutagenesis (QuickChange ...
-
bioRxiv - Biochemistry 2021Quote: Flag-GFP-tagged UCH37 (WT, C88A, C88S or EWI) were cloned into pQCXIP (Clontech). Retroviruses were produced by co-transfection of pCI-VSVG (a gift from Garry Nolan ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Immunology 2023Quote: HA-tagged TRIM34ΔSPRY constructs were cloned in pQCXIP (TaKaRa Bio, San Jose, CA, #631516) by SbfI (New England BioLabs #R3642S ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 10% tetracycline-free fetal calf serum (FCS) (TaKaRa Bio, 631106), 2 mM L-Glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... C-terminally triple FLAG tagged MBP was inserted into pKK plasmids using InFusion cloning (Takara). To introduce C-terminally triple FLAG tagged UPF1 ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP-tagged B55α was PCR amplified from pEGFP-C1-B55α and cloned into pLPCX (Clontech) using NotI and ClaI sites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCRs were performed with sample-specific tagged-primers using the Takara LA Taq polymerase (Takara) and 5 ng of DNA as input ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... Purification of the His6-tagged protein was achieved by TALON® spin columns (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Cell Biology 2019Quote: GFP-tagged SAF-A alleles were cloned into the lentiviral expression vector pLVX-TetOne-puro (Takara) using In-Fusion cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...