Labshake search
Citations for Takara Bio :
1 - 50 of 6176 citations for Rat T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Immunocult-stimulated human CD3+ T cells were retrovirally transduced on Retronectin-coated plates (TaKaRa). 500 µL of cells per well at 0.5 × 106 cells/mL were supplemented with 0.5 mL retroviral supernatant and centrifuged for 90 minutes at 900 g at 32°C ...
-
bioRxiv - Molecular Biology 2022Quote: Clontech SMARTer Polymerase Chain Reaction kit (Takara) was used to produce compatible polyA-transcript cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the total extracted RNA was reverse-transcribed into cDNA for polymerase chain reaction amplification using the real-time polymerase chain reaction SYBR Green kit (TaKaRa, Guangzhou, China). The reverse transcription steps were as follows ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Microbiology 2021Quote: ... Lenti-X 293 T cells (Takara Bio) grown in 10 cm dish were transiently transfected with the following plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA was amplified using a fluorescent quantitative polymerase chain reaction (PCR) kit (TaKaRa) and an instrument (Applied Biosystems 7500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gamma-retroviral transduction was facilitated by RetroNectin (#T100B, Takara Bio). Transduced and non-transduced (NT ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were transferred to retronectin-coated (Takara) plates previously spinoculated with retroviral particles at 2000ξg for 1.5h ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was extracted from sorted T cells using the Macherey-Nagel NucleoSpin Tissue XS kit (Takara #740901.250). DNA encoding the CAR costimulatory domain was amplified from the extracted genomic DNA using the forward primer 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTGGTTATCACCCTTTA CTGC-3’ (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Neuroscience 2022Quote: ... and the AAVpro 293 T cell line (#632273, Takara) following the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... murine T cells were transferred to retronectin-coated (Takara) plates previously spinoculated with retroviral particles at 2000ξg for 1.5h ...
-
bioRxiv - Immunology 2022Quote: Transduction of T cells was performed with Retronectin (Takara) as previously described (22 ...
-
bioRxiv - Immunology 2023Quote: ... T cells were transduced by centrifugation on Retronectin (Takara)-coated plates.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Cell Biology 2019Quote: Virus titer was determined by quantitative Polymerase Chain Reaction (qPCR) using Adeno-X qPCR Titration Kit (Clontech) on an Applied Biosystems 7900HT.
-
bioRxiv - Cell Biology 2021Quote: Human embryonic kidney 293 T cells (HEK293T, Takara, Cat# 632180) were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... Samples showing the correct size band for heavy and light chain amplification in the respective wells were subsequently cloned into pAb20-hCHIgG1 (Synbio; for heavy chain) and pAb20-hCK (Synbio; for light chains) through in-fusion cloning (Takara). The ligated product was transformed to DH5-α competent cells ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Gal4 AD fused with SV40 large T-antigen (pGADT7-T) from the Matchmaker Gold Yeast Two-Hybrid System kit (Takara Bio) were used as positive control ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Cancer Biology 2019Quote: ... then subcloned into T-clone vector pMD19-T (TaKaRa) to generate pT-DMP-2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... then subcloned into T-clone vector pMD19-T (TaKaRa) to generate pT-DMP-1 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK-293 T cells were transfected with calcium phosphate (CalPhos, Clontech) in T75 flasks using 30 μg of plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Microbiology 2023Quote: Polymerase chain reaction (PCR) was conducted using ExTaq (TaKaRa) to amplify the SLST locus ...
-
bioRxiv - Molecular Biology 2024Quote: ... Polymerase chain reactions were performed using PrimeSTAR Max (Takara). Synthetic genes for mGreenLantern and mLychee were ordered from Integrated DNA Technologies.
-
bioRxiv - Immunology 2023Quote: Effector cells (NK92, T cells, and NK cells) were transduced with retroviral supernatants by centrifugation on RetroNectin (Takara) coated plates ...
-
bioRxiv - Developmental Biology 2022Quote: ... first-strand cDNA synthesis and subsequent cDNA amplification by 22 cycles of polymerase chain reaction (PCR) were performed using the SMARTer stranded RNA-seq kit (Takara). The synthesized first-strand cDNA and amplified cDNA were purified using Ampure XP Beads (Beckman Coulter) ...
-
bioRxiv - Genetics 2023Quote: ... and subjected to quantitative real-time polymerase chain reaction with a TB Green Premix Ex Taq II kit (Takara, RR820A). The PCR program consisted of 95°C for 1 minute ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Plant Biology 2020Quote: ... was used to generate templates to synthesize first chain cDNA using the PrimeScript™ RT Master Mix kit (TAKARA, Dalian, China), with three biological replicates sample ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: Using the Lenti-X 293 T cell line (Takara Bio Inc., Otsu, Japan) and the pLVSIN-EF1α-AcGFP-C1 vector ...
-
bioRxiv - Immunology 2022Quote: ... – PU6-pAzpa was co-transfected with plasmids expressing full-lengths mutant 2B4 TCR and CD3 subunits using Xfect transfection kit (TaKaRa). For incorporating pAzpa into TCR sites ...
-
bioRxiv - Genomics 2020Quote: ... and inserted into a pMD20-T vector using the Mighty TA-cloning kit (TaKaRa Bio). The sequence of LFY coding sequence (CDS ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 3′ and 5′ rapid-amplification of cDNA ends Polymerase Chain Reaction (RACE-PCR) was carried out by using the SMART™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Immunology 2022Quote: ... TCR α- and β-chain genes were reverse transcribed and amplified from the RNA using the SMARTer RACE Kit (Clontech Laboratories, Inc). The amplified TCR genes were sub-cloned into the pEF- 1α/pENTR vector (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...