Labshake search
Citations for Takara Bio :
1 - 50 of 4922 citations for Protein Labeling kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... using Random Primer DNA Labeling Kit (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... prepared using a random primer labeling kit (Takara)79.
-
bioRxiv - Molecular Biology 2024Quote: ... using a random primer DNA labeling kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Random Primer DNA Labeling Kit (TaKaRa, 6045) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... or IMPA1L 120nt fragment were labeled using Random Priming Labeling Kits (Takara or Roche) and [α−32P] dCTP ...
-
bioRxiv - Immunology 2023Quote: ... Probes (50 ng) were labeled with 32P using the Ladderman DNA labeling kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Plant Biology 2023Quote: ... and then probes for siRNA detection were made using the BcaBEST Labeling Kit (Takara Bio) with [α-32P]dCTP (PerkinElmer ...
-
bioRxiv - Synthetic Biology 2020Quote: Labeling of T7 RNA polymerase (Takara bio) was performed using Alexa Fluor™ 647 Protein Labeling kit (Thermo scientific ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Detection relied on a 32P-labeled DNA probe specific for GFP sequence synthesized with a random priming labeling kit (Takara) followed by exposure to film and development as described (43).
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: ... The Bradford protein assay kit was purchased from Takara Bio (Shiga ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were determined via the Bradford method using the TaKaRa Bradford Protein Assay Kit (Takara Bio, T9310A).
-
bioRxiv - Physiology 2022Quote: ... We used the Bradford Protein Assay Kit (TAKARA, T9310A, Shiga, Japan).
-
bioRxiv - Cell Biology 2024Quote: ... The protein concentration was determined by using Bradford assay kit (Takara). For the vehicle control and inhibitor-treated or 5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Single labeling involved exposure of sections to 1:25,000 or 1:100,000 anti-DSRed (Takara), 1:500 anti-rabbit IgG ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... The concentration of tissue extracts was quantified using a BCA Protein Assay Kit (Takara). Samples were electrophoresed on 10% TGX Stain-Free gel (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...