Labshake search
Citations for Takara Bio :
1 - 50 of 4965 citations for Protein Concentration kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were measured using BCA Protein Assay Kit (TaKaRa). The samples were subjected to SDS-PAGE ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit, Takara, Shiga, Japan). SDS-PAGE and Western blotting were performed as previously described (Shintani et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein concentration was determined by using Bradford assay kit (Takara). For the vehicle control and inhibitor-treated or 5 ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were determined via the Bradford method using the TaKaRa Bradford Protein Assay Kit (Takara Bio, T9310A).
-
bioRxiv - Developmental Biology 2023Quote: ... The concentration of tissue extracts was quantified using a BCA Protein Assay Kit (Takara). Samples were electrophoresed on 10% TGX Stain-Free gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein concentration was measured using a BCA assay kit (Takara Bio Inc., Kusatsu, Siga, Japan). Twenty micrograms (µg ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was determined by Bradford assay (TAKARA). Nickel affinity purification of 10His-SUMO1T95R conjugates was carried out with Ni-NTA agarose beads (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Synthetic Biology 2021Quote: ... concentrated proteins were determined those concentrations with Bradford (Takara Bio) or BCA (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the protein concentration was assessed and quantified using BCA (TaKaRa, Japanese). Immunoblotting was conducted on cell and tissue extracts (30 μg total protein/well ...
-
bioRxiv - Biochemistry 2021Quote: ... an aliquot of the lysate was used to measure protein concentration by BCA protein assay (Takara Bio). The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer) ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The protein concentration of each tissue was determined by BCA method (TaKaRa, Lot#A4401A). The tissue protein was used for SDS-PAGE electrophoresis at the same quality ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined by bicinchoninic acid assay using bovine serum albumin (TaKaRa Bio) as the reference standard ...
-
bioRxiv - Microbiology 2024Quote: ... Library concentration was estimated with the Library Quantification kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Cell Biology 2023Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Immunology 2022Quote: ... p24Gag concentrations were quantitated using the Lenti-X p24Gag Rapid Titer Kit (Clontech). For infection ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV stock concentration was determined using the Takara AAV Titration kit (Takara #6233) and an Applied Biosystems 7500 Fast Real-Time PCR System.
-
bioRxiv - Biochemistry 2023Quote: ... The Bradford protein assay kit was purchased from Takara Bio (Shiga ...
-
bioRxiv - Physiology 2022Quote: ... We used the Bradford Protein Assay Kit (TAKARA, T9310A, Shiga, Japan).
-
bioRxiv - Biochemistry 2022Quote: ... The molar concentration of the sequencing library was determined using the library quantitation kit from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant protein was purified using the His60 Ni gravity column purification kit (Takara Bio) according to the manual instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... to a final concentration of 108-109 IFU/ml using the Lenti-x qRT-PCR Titration Kit (Takara, cat.631235). Lentivirus with MOI of 10 was used for transduction of MOVAS cells ...